ID: 968178063

View in Genome Browser
Species Human (GRCh38)
Location 3:196568605-196568627
Sequence GCAGCCAAACAGTCACATCC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 462
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 437}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968178052_968178063 20 Left 968178052 3:196568562-196568584 CCCGCCGGCGCCCAATCCCGTCG 0: 1
1: 0
2: 0
3: 4
4: 51
Right 968178063 3:196568605-196568627 GCAGCCAAACAGTCACATCCGGG 0: 1
1: 0
2: 1
3: 23
4: 437
968178051_968178063 25 Left 968178051 3:196568557-196568579 CCTCACCCGCCGGCGCCCAATCC 0: 1
1: 1
2: 0
3: 11
4: 199
Right 968178063 3:196568605-196568627 GCAGCCAAACAGTCACATCCGGG 0: 1
1: 0
2: 1
3: 23
4: 437
968178060_968178063 3 Left 968178060 3:196568579-196568601 CCGTCGAGCGTCAGGCGTGAGGC 0: 1
1: 0
2: 0
3: 2
4: 30
Right 968178063 3:196568605-196568627 GCAGCCAAACAGTCACATCCGGG 0: 1
1: 0
2: 1
3: 23
4: 437
968178058_968178063 4 Left 968178058 3:196568578-196568600 CCCGTCGAGCGTCAGGCGTGAGG 0: 1
1: 0
2: 0
3: 1
4: 41
Right 968178063 3:196568605-196568627 GCAGCCAAACAGTCACATCCGGG 0: 1
1: 0
2: 1
3: 23
4: 437
968178056_968178063 10 Left 968178056 3:196568572-196568594 CCCAATCCCGTCGAGCGTCAGGC 0: 1
1: 0
2: 0
3: 1
4: 15
Right 968178063 3:196568605-196568627 GCAGCCAAACAGTCACATCCGGG 0: 1
1: 0
2: 1
3: 23
4: 437
968178054_968178063 16 Left 968178054 3:196568566-196568588 CCGGCGCCCAATCCCGTCGAGCG 0: 1
1: 0
2: 0
3: 2
4: 10
Right 968178063 3:196568605-196568627 GCAGCCAAACAGTCACATCCGGG 0: 1
1: 0
2: 1
3: 23
4: 437
968178053_968178063 19 Left 968178053 3:196568563-196568585 CCGCCGGCGCCCAATCCCGTCGA 0: 1
1: 0
2: 1
3: 9
4: 30
Right 968178063 3:196568605-196568627 GCAGCCAAACAGTCACATCCGGG 0: 1
1: 0
2: 1
3: 23
4: 437
968178057_968178063 9 Left 968178057 3:196568573-196568595 CCAATCCCGTCGAGCGTCAGGCG 0: 1
1: 0
2: 0
3: 1
4: 15
Right 968178063 3:196568605-196568627 GCAGCCAAACAGTCACATCCGGG 0: 1
1: 0
2: 1
3: 23
4: 437

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968178063 Original CRISPR GCAGCCAAACAGTCACATCC GGG Exonic
900311793 1:2036984-2037006 GCAGCCAAACAGACTCAGGCAGG - Intergenic
901966522 1:12872718-12872740 GCAGGCAAACATTCAAATTCAGG - Intronic
901981915 1:13042967-13042989 GCAGGCAAACATTCAAATTCAGG - Intronic
902000168 1:13185946-13185968 GCAGGCAAACATTCAAATTCAGG + Intergenic
902019416 1:13331713-13331735 GCAGGCAAACATTCAAATTCAGG + Intergenic
902806601 1:18865096-18865118 GCAGCCATGCACCCACATCCAGG + Intronic
903622039 1:24704828-24704850 GTAGCCTAACAGCCTCATCCTGG - Intergenic
904811543 1:33166166-33166188 GCAGCTAGACAGTCCCATCTGGG - Intronic
904962374 1:34344022-34344044 GCAGCTAAATGGTTACATCCTGG + Intergenic
905354391 1:37371251-37371273 ACACCCACACAGACACATCCAGG - Intergenic
906836464 1:49087703-49087725 GCAGGCCAACATTCAAATCCAGG + Intronic
906908090 1:49916699-49916721 GCAGGCCAACATTCACATTCAGG + Intronic
907528314 1:55067617-55067639 GCAGCCAGACAGGCACTTCAGGG + Exonic
907780889 1:57564889-57564911 GCAGGCCAACATTCACATTCAGG + Intronic
907822760 1:57987265-57987287 CCAGCCACATAGACACATCCGGG + Intronic
909423076 1:75488083-75488105 GCAACCAGACAGTCCCATCTGGG - Intronic
910930099 1:92435293-92435315 GCAGGCCAACATTCACATTCAGG - Intergenic
913236004 1:116784096-116784118 GCTCCCAACCAGTCACACCCAGG - Intergenic
913285156 1:117219214-117219236 GCAGGCCAACATTCAAATCCAGG + Intergenic
913467252 1:119155799-119155821 GCAGGCCAACATTCACATTCAGG - Intergenic
914858242 1:151367409-151367431 GCATCCAAAGGGTCTCATCCAGG + Intronic
915026176 1:152831842-152831864 GCAGGCCAACAGTCAAATTCAGG + Intergenic
915651713 1:157316879-157316901 GCAGGCAAACATTCAAATTCAGG + Intergenic
915763379 1:158337684-158337706 GCAGGCCAACATTCACATTCAGG + Intergenic
916592898 1:166210332-166210354 ACACCCAAACAGACACACCCAGG - Intergenic
917252291 1:173075549-173075571 GCAGGCCAACATTCACATTCAGG + Intergenic
917259884 1:173155337-173155359 GCAGGCCAACATTCACATTCAGG + Intergenic
917275217 1:173323977-173323999 GCAGGCCAACATTCACATTCAGG + Intergenic
917700745 1:177578371-177578393 CCCTCCAATCAGTCACATCCAGG + Intergenic
917794471 1:178522511-178522533 GAAGCCAAAGAATCACACCCAGG - Exonic
917901554 1:179547884-179547906 CCATCCAAACAGTCAAACCCAGG + Intronic
918826352 1:189329794-189329816 GCAGGCAAACATTCAGATTCAGG - Intergenic
924840017 1:247698870-247698892 GCAACCAGACAGTCCCATCTGGG + Intergenic
1064553293 10:16523122-16523144 GCAAGCAAACAGTAACATCCTGG + Intergenic
1064900989 10:20295938-20295960 GCAGGCAAACATTCAGATTCAGG - Intergenic
1066363337 10:34752176-34752198 GCTGCAAAACTGTCACATACTGG + Intronic
1066582569 10:36897459-36897481 GCAGGCCAACATTCACATTCAGG - Intergenic
1067333536 10:45343078-45343100 GCAGCCCAACATTCAAATTCAGG + Intergenic
1068991028 10:63150778-63150800 GCAGCTAGACAGTCTCATCTAGG + Intronic
1069300486 10:66900993-66901015 GCAGGCCAACATTCACATTCAGG + Intronic
1071349808 10:84728750-84728772 GCAGGCAAACAATCAAATTCAGG + Intergenic
1071912559 10:90252092-90252114 GCAGCCCAACATTCACATTCAGG + Intergenic
1072245135 10:93536594-93536616 GCAGGCCAACAGTCAAATTCAGG + Intergenic
1072382932 10:94893951-94893973 GCAGGCCAACATTCACATTCAGG + Intergenic
1073008016 10:100339483-100339505 GCAGGCACAGAGTCTCATCCAGG - Intergenic
1073556879 10:104462248-104462270 GCACCCTCACAGACACATCCAGG - Intergenic
1074431262 10:113396848-113396870 GCAGACAACCAGTCAGATACTGG + Intergenic
1074464424 10:113668804-113668826 GCACCCTCACAGACACATCCAGG + Intergenic
1075112097 10:119596230-119596252 TCCCCCAAACAGTCACTTCCTGG - Intronic
1076419370 10:130318898-130318920 GCAGGCCAACATTCACATTCAGG - Intergenic
1076523510 10:131095418-131095440 GCAGCCATACAGTCCCGTCCTGG - Intronic
1077683019 11:4263967-4263989 GCAGCCCAACATTCAAATTCAGG + Intergenic
1077687022 11:4302791-4302813 GCAGCCCAACATTCAAATTCAGG - Intergenic
1077692179 11:4353980-4354002 GCAGCCCAACATTCAAATTCAGG - Intergenic
1077697213 11:4405325-4405347 GCAGCCCAACATTCAAATTCAGG - Intergenic
1077788692 11:5413898-5413920 GCAGGCAAACATTCAGATTCAGG + Intronic
1078200575 11:9178977-9178999 CCAGCTAAACATTCAGATCCGGG - Exonic
1078598966 11:12714186-12714208 GTTCCCAAGCAGTCACATCCAGG + Intronic
1078714207 11:13824535-13824557 GCAGGCCAACATTCACATTCAGG - Intergenic
1078726616 11:13937894-13937916 GCAGGCCAACATTCACATTCAGG - Intergenic
1078977859 11:16497932-16497954 GCAGGCCAACATTCACATTCAGG + Intronic
1078980025 11:16522095-16522117 GCAGGCCAACATTCACATTCAGG + Intronic
1079309250 11:19349843-19349865 GCAGACACTCAGTCACCTCCCGG - Intergenic
1079876806 11:25868477-25868499 GCATCTAAACAGTAACATGCAGG - Intergenic
1079916557 11:26375120-26375142 GCAACTAAACAGTCTCATCTGGG + Intronic
1080736088 11:35015313-35015335 GCAGGGAAAAAGTCACCTCCAGG + Intronic
1082568785 11:54713093-54713115 GCAGGCCAACATTCACATTCAGG - Intergenic
1082606225 11:55237351-55237373 GCAGGCCAACATTCACATTCAGG - Intergenic
1082618968 11:55397791-55397813 GCAGGCTAACAGTCAAATTCAGG - Intergenic
1082684498 11:56221061-56221083 GCAGGCAAACATTCAAATTCAGG + Intergenic
1083503309 11:63131805-63131827 GCAGGCCAACATTCAAATCCAGG - Intronic
1084320119 11:68368708-68368730 ACAGACACACAGTCACATACAGG - Intronic
1084727932 11:70954053-70954075 GCAGCACAACAGGGACATCCTGG + Intronic
1085462100 11:76700406-76700428 GCAGCCAGACAATCATTTCCTGG - Intergenic
1085800860 11:79587703-79587725 GCAGGCCAACATTCACATTCAGG + Intergenic
1087916649 11:103819338-103819360 GCAGGCCAACATTCACATTCAGG - Intergenic
1088431804 11:109767250-109767272 GCAGCAGAACAATCTCATCCAGG + Intergenic
1088579787 11:111303535-111303557 GCAGACAAACAGGCCAATCCGGG + Intronic
1088736277 11:112730218-112730240 GCAACTAAACAGTCCCATCTAGG - Intergenic
1089109903 11:116047140-116047162 ACAGACCAACATTCACATCCAGG - Intergenic
1092984701 12:13834541-13834563 GCAGCCAGACAGTGACATGATGG - Intronic
1093501419 12:19816105-19816127 GCAGGCCAACATTCACATTCAGG + Intergenic
1095604208 12:44047067-44047089 ACACCCATACAGACACATCCAGG - Intronic
1095793658 12:46194458-46194480 GCAGCCCAACATTCAAATTCAGG - Intronic
1095873803 12:47058321-47058343 GCAGGCCAACATTCACATTCAGG + Intergenic
1096801847 12:54115610-54115632 GCAGCCAAACAGTGACTGACAGG + Intergenic
1096954213 12:55509218-55509240 GCAGGCCAACATTCACATTCAGG - Intergenic
1097203001 12:57295630-57295652 GAATCCAAAAAGTCACATGCAGG + Intronic
1097568035 12:61295371-61295393 GCAGGCCAACATTCACATTCAGG + Intergenic
1098421555 12:70303743-70303765 GCAGGCCAACATTCACATTCAGG - Intronic
1099299012 12:80868216-80868238 GCATGCAAACAGTGACATGCTGG - Intronic
1100238197 12:92682725-92682747 GCAGGCCAACATTCACATTCAGG - Intergenic
1102619159 12:114180099-114180121 GCACCCACACAGGCACACCCAGG - Intergenic
1103035084 12:117650080-117650102 ACACCCACACAGACACATCCAGG - Intronic
1103481793 12:121254886-121254908 ACACCCACACAGACACATCCAGG - Intronic
1104246842 12:127051257-127051279 GCAGCTAAATAGTCCCATCTGGG - Intergenic
1104591368 12:130086672-130086694 GTAGCTAAACTGTGACATCCAGG - Intergenic
1104631086 12:130402651-130402673 GCGGCCAAACAGTAACTACCTGG + Intronic
1104716815 12:131020941-131020963 GCTGCCAACAAGACACATCCAGG - Intronic
1105405821 13:20131786-20131808 GGAGTCAGACAGTCACATCCAGG - Intergenic
1105598206 13:21860252-21860274 GCAGGCCAACATTCACATTCAGG - Intergenic
1107300192 13:38958056-38958078 GCAGCCCAGCAGTCACATCCTGG + Intergenic
1108168179 13:47713753-47713775 GCAGGCCAACATTCACATTCAGG + Intergenic
1108561930 13:51652931-51652953 GCAGGCCAACATTCACATTCAGG - Intronic
1108983870 13:56557711-56557733 ACAGCCTCACAGACACATCCAGG + Intergenic
1109385774 13:61627801-61627823 GCAGGCAAACATTCAAATCCAGG - Intergenic
1109389645 13:61676562-61676584 GCAGGCAAACAGTTATATCCTGG - Intergenic
1109659288 13:65437007-65437029 GCAGGCCAACATTCACATTCAGG + Intergenic
1110152280 13:72270012-72270034 GCAGGCCAACATTCACATTCAGG - Intergenic
1110180555 13:72611732-72611754 GCAGGCCAACATTCACATTCAGG + Intergenic
1110256524 13:73439751-73439773 GAAGCAAAAGAGTCAGATCCAGG - Intergenic
1110996040 13:82111114-82111136 GCAGGCAAACATTCAGATTCAGG + Intergenic
1111917264 13:94373679-94373701 GCAGGCCAACATTCACATTCAGG + Intronic
1112692682 13:101915830-101915852 GCAGCCCTTCAGTCAAATCCTGG - Intronic
1112899824 13:104344878-104344900 GCAGGCAAACATTCAGATTCAGG - Intergenic
1113784462 13:112995113-112995135 GCCACCAAACAGCCGCATCCTGG - Intronic
1115278828 14:31638615-31638637 GCAGGCCAACATTCACATTCAGG - Intronic
1115335245 14:32239124-32239146 GCAGGCCAACATTCACATTCAGG - Intergenic
1115391067 14:32855688-32855710 GCAGGCCAACATTCACATTCAGG - Intergenic
1115946929 14:38672514-38672536 GCAGGCCAACATTCAAATCCAGG + Intergenic
1116871881 14:50075451-50075473 GCAGGCCAACATTCAAATCCAGG + Intergenic
1117123534 14:52595344-52595366 GCAGGCCAACATTCAAATCCAGG - Intronic
1117493394 14:56275478-56275500 GCAACCAGACAGTCCCATCTGGG + Intronic
1117945340 14:61013910-61013932 GCAGGCCAACATTCACATTCAGG - Intronic
1118483201 14:66188255-66188277 GCAGCCCAACATTCAGATTCAGG - Intergenic
1118484611 14:66202071-66202093 GCAGCCCAACATTCAGATTCAGG + Intergenic
1118535907 14:66763988-66764010 GCAGCTAGACAGTCCCATCTGGG - Intronic
1118818771 14:69331254-69331276 GGAGCCAAATAGGAACATCCAGG + Intronic
1119703241 14:76769034-76769056 GCAGCCAAACTGCCAGATCCGGG + Intronic
1120064893 14:80029161-80029183 GCAGGCCAACATTCACATTCAGG + Intergenic
1120069829 14:80090131-80090153 GCAGGCCAACATTCACATTCAGG + Intergenic
1120231875 14:81849005-81849027 GCACCCTCACAGTCACACCCAGG + Intergenic
1120992274 14:90387999-90388021 GCAGCCTAAAAGTCACATAATGG - Intergenic
1122074166 14:99224975-99224997 GGAGCCCACCAGACACATCCTGG - Intronic
1122305477 14:100763426-100763448 GCAGCTAGACAGTCCCATCTGGG + Intergenic
1202846497 14_GL000009v2_random:182358-182380 GCAGGCCAACATTCACATTCAGG - Intergenic
1202915960 14_GL000194v1_random:172960-172982 GCAGGCCAACATTCACATTCAGG - Intergenic
1124580260 15:30947172-30947194 GGTGCCAAACAGTGAGATCCGGG + Exonic
1124669130 15:31622290-31622312 GCAGGCCAACATTCACATTCAGG - Intronic
1124670090 15:31631615-31631637 GCAGGCAAACATTCAGATTCAGG - Intronic
1124714793 15:32050172-32050194 GCAGGCCAACATTCACATTCAGG - Intronic
1125135210 15:36333254-36333276 GCAGCTAGACAGTCCCATCTTGG - Intergenic
1130630136 15:85559564-85559586 GCAGCTAAACAGTCCCATCAGGG + Intronic
1133650368 16:7807016-7807038 GCAGCTAGACAGTCCCATCTGGG - Intergenic
1133938799 16:10291236-10291258 GCAGGCAAACATTCAAATTCAGG - Intergenic
1134859666 16:17549948-17549970 GCACCCACACAGACACACCCAGG - Intergenic
1136005594 16:27326842-27326864 GGAGCCAACCAGGCAGATCCCGG + Intronic
1136675822 16:31905312-31905334 GCAGGCAAACATTCAAATTCAGG - Intronic
1138207841 16:55137930-55137952 GCAGCCAAACAGCCATCTCAGGG + Intergenic
1139356360 16:66369143-66369165 ATAGCAAAACAGTCAGATCCTGG + Intronic
1140236345 16:73162375-73162397 GCAGCCAAAGAGTCCCATGTGGG - Intergenic
1140274186 16:73494083-73494105 GCAGGCAAAGAGTCGCTTCCCGG + Intergenic
1140537213 16:75720718-75720740 GCAGGCCAACATTCACATTCAGG + Intronic
1140539090 16:75739355-75739377 GCAGGCCAACATTCACATTCAGG - Intronic
1141425089 16:83939664-83939686 GGAGAGAAACAGTCACGTCCAGG + Intronic
1142402557 16:89868114-89868136 GCTGAGAAACAGTCGCATCCCGG - Intronic
1142685281 17:1574131-1574153 CCAGCCAAACAGGCGAATCCTGG - Intronic
1147555525 17:41476633-41476655 GCTGCCCAACAGTCACCCCCTGG + Intergenic
1149359389 17:55877831-55877853 GCAGGCAAACATTCAAATTCAGG - Intergenic
1151300678 17:73222901-73222923 GCAGCCCAACAACCACACCCTGG + Intronic
1153064778 18:1033843-1033865 GCAGGCCAACATTCAAATCCAGG - Intergenic
1153588305 18:6646484-6646506 GCAGGCAAACAGTCACAGTACGG - Intergenic
1156892460 18:42205553-42205575 ACAGCCAAACAGTATCATCCTGG - Intergenic
1157025453 18:43837092-43837114 GCAGGCAAACATTCAAATTCAGG + Intergenic
1157205662 18:45696063-45696085 GCAGCCCAACATTCAAATTCAGG + Intergenic
1158111664 18:53946798-53946820 GCAATCAATCAGCCACATCCTGG + Intergenic
1158933385 18:62342532-62342554 GCAGCAAAACATTCATAACCAGG - Intronic
1159529406 18:69636458-69636480 GAAGCCATCCAGGCACATCCAGG + Intronic
1161486383 19:4538110-4538132 GCAGCCAAACTGGGACATGCGGG - Exonic
1163881003 19:19922464-19922486 GCAGCCCAACATTCAAATTCAGG - Intronic
1164542889 19:29134201-29134223 GCAGGCCAACATTCACATTCAGG + Intergenic
1165553617 19:36609702-36609724 CCAGGCAACCAGTCACATTCAGG + Intronic
1167302341 19:48685487-48685509 CCAGCCACCCAGTCCCATCCTGG + Intergenic
925900200 2:8503808-8503830 GCACCCACACAGACACACCCAGG - Intergenic
927161265 2:20264835-20264857 GCAGTAAAACAGTCAAATCCTGG + Intronic
928785197 2:34875745-34875767 ACAGCAACACAGTTACATCCTGG + Intergenic
930437441 2:51363218-51363240 GCAGGCCAACATTCAAATCCAGG - Intergenic
931594663 2:63928128-63928150 GCAGGCCAACATTCACATTCAGG + Intronic
931650630 2:64465713-64465735 GCAACCAGACAGTCCCATCTGGG + Intergenic
932649528 2:73539986-73540008 GCAGGCCAACATTCACATTCAGG + Intronic
932855400 2:75228440-75228462 GCACCCTCACAGACACATCCAGG + Intergenic
938124280 2:128660686-128660708 GCAGACAAAGAGTCCCACCCAGG - Intergenic
938718627 2:134044355-134044377 GCAGGCCAACATTCACATTCAGG + Intergenic
939014161 2:136882192-136882214 GCAACCTAACAGTCACTTGCTGG + Exonic
939030953 2:137075112-137075134 GCAGGCCAACATTCAAATCCAGG - Intronic
939844481 2:147226951-147226973 GAAGTTAAACAGTTACATCCTGG + Intergenic
939940598 2:148346021-148346043 GCACCCACACAGACACACCCAGG + Intronic
940329669 2:152460817-152460839 GCAACTAGACAGTCCCATCCAGG - Intronic
940379441 2:152997327-152997349 GCAGGCCAACAGTCAGATTCAGG + Intergenic
941303010 2:163827765-163827787 GCCATCAAAGAGTCACATCCTGG + Intergenic
941534578 2:166707257-166707279 GCAGGCCAACATTCACATTCAGG - Intergenic
941559517 2:167027030-167027052 GCAGGCCAACATTCACATTCAGG - Intronic
941776690 2:169400780-169400802 GCAGGCCAACATTCACATTCAGG + Intergenic
941781950 2:169454380-169454402 GCAGGCCAACATTCACATTCAGG + Intergenic
942056786 2:172191794-172191816 GCAGGCCAACATTCACATTCAGG - Intergenic
942065656 2:172269225-172269247 GCAGGCCAACATTCAAATCCAGG - Intergenic
942411895 2:175718183-175718205 GCAGCCCAACATTCAAATTCAGG + Intergenic
942742658 2:179197424-179197446 GCAGGCCAACATTCACATTCAGG + Intronic
942796762 2:179829811-179829833 GCATCTAAAAAGTCATATCCAGG - Intronic
942859269 2:180590133-180590155 GCAGCCCAACATTCAAATTCAGG - Intergenic
943392407 2:187285760-187285782 GCAGCCTCACAGACACACCCAGG + Intergenic
943509333 2:188804431-188804453 GCATCCTCACAGACACATCCAGG - Intergenic
944304888 2:198168073-198168095 GCAGAAAAACAGTCATACCCTGG - Intronic
945343409 2:208684882-208684904 GCAGGCCAACATTCACATTCAGG - Intronic
945348682 2:208751014-208751036 GCAGGCCAACATTCACATTCAGG - Intronic
945351517 2:208785878-208785900 GCAGGCCAACATTCACATTCAGG + Intronic
945352838 2:208802250-208802272 GCAGGCCAACATTCACATTCAGG + Intronic
946454946 2:219818033-219818055 GCAGGCAAACATTCAAATTCAGG - Intergenic
947244591 2:228032496-228032518 GCAGGCAAACATTCAGATCCAGG + Intronic
947261975 2:228233556-228233578 GCAGGCAAACATTCAGATTCAGG - Intergenic
947695274 2:232181338-232181360 GCAGCCCAACATTCAGATTCAGG - Intronic
947718998 2:232356718-232356740 GCAGCCCAACATTCAGATTCAGG + Intergenic
947843165 2:233221886-233221908 GCACCCTCACAGACACATCCAGG + Intronic
948179351 2:235967205-235967227 GCAGAGAAACAGTCAGAGCCTGG - Intronic
1168822665 20:786105-786127 TCAGCCAAGCATTTACATCCTGG + Intergenic
1169861828 20:10160667-10160689 GCAGGCCAACATTCACATTCAGG + Intergenic
1170186317 20:13594841-13594863 GCAGGCCAACATTCAAATCCAGG + Intronic
1170496136 20:16927331-16927353 GCAGTCAAACTGTCACCTGCAGG + Intergenic
1170660529 20:18334535-18334557 GCAGGCCAACATTCACATTCAGG + Intergenic
1170707632 20:18759761-18759783 GCAGGCCAACATTCACATTCAGG - Intronic
1170719683 20:18865739-18865761 GCAGGCCAACATTCACATTCAGG - Intergenic
1171794864 20:29558856-29558878 GCAGCCAAACAGTGACTGACAGG - Intergenic
1171814230 20:29769301-29769323 GCAGGCCAACATTCACATTCAGG + Intergenic
1171819248 20:29818326-29818348 GCAGGCCAACATTCACATTCAGG + Intergenic
1171853593 20:30325409-30325431 GCAGCCAAACAGTGACTGACAGG + Intergenic
1172754314 20:37272686-37272708 CCAGCTTAAAAGTCACATCCTGG - Intergenic
1173718827 20:45235724-45235746 GCAGCCATTAATTCACATCCTGG - Intergenic
1174696790 20:52567898-52567920 GCAGACAAAAAGCCCCATCCAGG + Intergenic
1174925365 20:54753390-54753412 GCAGGCCAACATTCAAATCCAGG - Intergenic
1176276795 20:64277026-64277048 ACAGCCACACAGACACACCCAGG + Intronic
1176635314 21:9187607-9187629 GCAGGCCAACATTCACATTCAGG - Intergenic
1178108953 21:29351715-29351737 TCAGCTAAACAGTAACATCTGGG + Intronic
1178420566 21:32439700-32439722 GCAGCAAAAAAGCCACAGCCTGG - Intronic
1179534329 21:42041553-42041575 GCCGCAGAACAGTCACATCAGGG - Intergenic
1180190337 21:46159882-46159904 GCAGCCACACAGTCTCGGCCAGG - Intergenic
1180317685 22:11289881-11289903 GCAGGCCAACATTCACATTCAGG + Intergenic
1180323233 22:11343022-11343044 GCAGGCCAACATTCACATTCAGG + Intergenic
1180833028 22:18915759-18915781 GCAGCCAACAGGACACATCCTGG - Intronic
1181066792 22:20310495-20310517 GCAGCCAACAGGACACATCCTGG + Intergenic
1181373418 22:22436760-22436782 GCACCCTAACAGACACACCCAGG + Intergenic
1182996593 22:34818389-34818411 GCAGGCAAACATTCAAATTCAGG + Intergenic
1183286168 22:36965614-36965636 GTGGCCAAAGAGTCACATTCTGG - Intergenic
1185116337 22:48940385-48940407 GAAGCCAGGCAGTGACATCCAGG + Intergenic
1203283112 22_KI270734v1_random:141063-141085 GCAGCCAACAGGACACATCCTGG - Intergenic
949198350 3:1340631-1340653 GCAGACAAAGAGTCACACCCAGG + Intronic
949865344 3:8542550-8542572 CCAGAGAAACAGACACATCCAGG + Intronic
949912472 3:8923529-8923551 GCAGCCCAACATTCACATTCAGG + Intronic
950828788 3:15854026-15854048 GCAGACAAACAGGGACACCCAGG - Intronic
952639363 3:35573842-35573864 TCAGCAAATCAGTCACATCTTGG - Intergenic
955030382 3:55210731-55210753 GCAGGTAAACATTCACATTCAGG + Intergenic
955048987 3:55390323-55390345 GCAGGCCAACATTCACATTCAGG + Intergenic
955135616 3:56214608-56214630 GCAGGCCAACATTCACATTCAGG + Intronic
955829005 3:62981557-62981579 GCTGCCAAACACACACATACTGG + Intergenic
956682837 3:71797516-71797538 GGAGCCAGACAGGCACATCCTGG - Intergenic
957583752 3:82109412-82109434 GCAGGCAAACATTCAAATTCAGG - Intergenic
957942380 3:87021426-87021448 GCAGACAAACAGCCAAATCATGG + Intergenic
959724416 3:109527716-109527738 GCAGGCAAACACTCAAATTCAGG - Intergenic
960448724 3:117779581-117779603 GCAGGCCAACATTCACATTCAGG + Intergenic
960753032 3:120978071-120978093 GCAGGCCAACATTCACATTCAGG - Intronic
960792647 3:121450815-121450837 GCAGCCCAACATTCAAATTCAGG - Intronic
960793035 3:121453846-121453868 GCAGGCCAACATTCACATTCAGG + Intronic
962643652 3:137414084-137414106 GCAGGCCAACATTCACATTCAGG + Intergenic
964264318 3:154876584-154876606 GCAGTCCAACATTCACATTCAGG + Intergenic
965886260 3:173450588-173450610 GCAGGCCAACATTCACATTCAGG - Intronic
966136739 3:176707153-176707175 GCAGGCAAACATTCAAATTCAGG + Intergenic
966147569 3:176828517-176828539 GCAGGCAAACATTCAAATTCAGG + Intergenic
967758408 3:193196502-193196524 GCACCCTCACAGACACATCCAGG + Intergenic
968178063 3:196568605-196568627 GCAGCCAAACAGTCACATCCGGG + Exonic
969226594 4:5802595-5802617 GCAGCTAGACAATCACATCTGGG + Intronic
969612486 4:8235222-8235244 GCAGCTGCACAGTCACCTCCTGG + Intronic
969821315 4:9722487-9722509 GCAGCAAAAAAGCCACAGCCTGG - Intergenic
970051455 4:11919146-11919168 GCAACCAGACAGTCCCATCTAGG - Intergenic
971189119 4:24410561-24410583 ACATCCTAACAGACACATCCAGG - Intergenic
971431925 4:26577456-26577478 CCAGCCAAACAGTCCCCTCCTGG + Intronic
972119408 4:35681687-35681709 GCAGGCCAACAGTCAGATTCAGG - Intergenic
972192743 4:36614161-36614183 ACACCCAAACAGACACACCCAGG - Intergenic
972340944 4:38151957-38151979 CCAGCCACAAAGTCACATCTTGG + Intergenic
972996120 4:44881052-44881074 GCAGGCCAACATTCACATTCAGG + Intergenic
973987064 4:56364333-56364355 GCAGGCCAACATTCACATTCAGG + Intronic
974044490 4:56886198-56886220 GCAGGCAAACATTCAAATTCAGG + Intergenic
975503363 4:75111464-75111486 GCAGGCAAACATTCAAATTCAGG + Intergenic
975813514 4:78194298-78194320 GCAGGCCAACATTCACATTCAGG - Intronic
976342024 4:83956710-83956732 GCAGCCCAACATTCAGATTCAGG - Intergenic
979453489 4:120900290-120900312 CCTGGCAAACAGTCCCATCCTGG + Intronic
980149212 4:129025164-129025186 GCAGGCCAACATTCACATTCAGG + Intronic
980231378 4:130050727-130050749 GCAGGCCAACATTCACATTCAGG - Intergenic
980255867 4:130380771-130380793 GCACCCTCACAGACACATCCAGG - Intergenic
981621820 4:146709284-146709306 GCAGCCAAACAGTTAAATGCAGG - Intronic
982100061 4:151958861-151958883 ACAGCCAAACTGCCACTTCCTGG + Intergenic
984015070 4:174416422-174416444 GCAGGCAAACATTCAGATTCAGG - Intergenic
987184914 5:15407479-15407501 GCAACCAGACAGTCCCATCCGGG + Intergenic
988185379 5:27854367-27854389 ACACCCACACAGACACATCCAGG - Intergenic
988859254 5:35260488-35260510 GCAGGCCAACATTCAAATCCAGG - Intergenic
988943125 5:36166570-36166592 GCAACCGACCAGTCACATCCGGG - Exonic
989942735 5:50173316-50173338 GCAGGCCAACATTCACATTCAGG - Intergenic
990508504 5:56468501-56468523 GCAGCCCAAGAATAACATCCAGG + Intronic
990710466 5:58574396-58574418 GCAGGCCAACATTCACATTCAGG + Intergenic
993670386 5:90753322-90753344 GCAGCCAAATTGTCAAATACTGG - Intronic
993742403 5:91556986-91557008 GCAGCCCAACATTCAAATTCAGG + Intergenic
994161041 5:96556824-96556846 GCAGGCCAACATTCAAATCCAGG + Intronic
994758835 5:103828058-103828080 GCTGGCAAAGAGTCAGATCCAGG - Intergenic
995202874 5:109446143-109446165 GCAGGCCAACATTCACATTCAGG - Intergenic
995204074 5:109458855-109458877 GCAGGCCAACATTCACATTCAGG + Intergenic
995321288 5:110837145-110837167 GCAGTGGCACAGTCACATCCAGG - Intergenic
995529315 5:113076274-113076296 GCAGACCAACATTCACATTCAGG + Intronic
996012915 5:118501296-118501318 GCAGGCCAACATTCACATTCAGG - Intergenic
996275540 5:121661518-121661540 GCAGGCAAACATTCAAATTCAGG + Intergenic
996320118 5:122206020-122206042 GCAGGCCAACATTCACATTCAGG + Intergenic
997185005 5:131872613-131872635 GCAGGCCAACATTCACATTCAGG + Intronic
997528232 5:134567056-134567078 GCAGCCAAACAGGCACGTGCCGG + Intronic
998685232 5:144517071-144517093 GCAGGCCAACATTCACATTCAGG - Intergenic
998869844 5:146541247-146541269 GCAGCCTTCCAGTCACATGCAGG + Intergenic
998959397 5:147469035-147469057 GCAGCCAATCAGCCACCACCAGG + Intronic
999570826 5:152918211-152918233 GCAGGCCAACATTCAGATCCAGG - Intergenic
1001116714 5:168946538-168946560 GCAGCACAACAGTGACATCCAGG + Intronic
1001677227 5:173528675-173528697 GCAGCCATGGAGTCACATGCTGG + Intergenic
1002136919 5:177113252-177113274 GCAGCCTAACAGTTACAGGCAGG + Intergenic
1005820444 6:29594106-29594128 GCAGCTAAACACTCAAGTCCTGG - Intronic
1006686307 6:35837530-35837552 GGAGCCAGACTGTCAAATCCTGG - Intronic
1006985510 6:38173093-38173115 GGAGCCAGACAGTCATATCAAGG - Exonic
1008363429 6:50648575-50648597 GCAGGCCAACAGTCAAATTCAGG - Intergenic
1009457802 6:63877497-63877519 GCAGCCCAACAGTCAAATTCAGG - Intronic
1010513850 6:76750175-76750197 GCAGGCCAACATTCACATTCAGG - Intergenic
1010629496 6:78180539-78180561 GCTGCCTACCAGTCACATACTGG + Intergenic
1010827982 6:80496800-80496822 GCAGGCAAACATTCAGATTCAGG - Intergenic
1010844201 6:80684830-80684852 GCAGGCAAACATTCAAATTCAGG + Intergenic
1011292765 6:85793593-85793615 GCAACCAGACAGTCTCATCTAGG - Intergenic
1012251393 6:96985398-96985420 GCAGGCCAACATTCACATTCAGG - Intronic
1012920433 6:105216838-105216860 GCACCCACACAGACACACCCAGG + Intergenic
1013578163 6:111506241-111506263 GCAGGCCAACAGTCAAATTCAGG - Intergenic
1013874227 6:114804435-114804457 GCAGGCCAACATTCACATTCAGG - Intergenic
1013947732 6:115742604-115742626 GCAGGCAAACATTCAGATTCAGG + Intergenic
1016144722 6:140655772-140655794 ACACCCTAACAGCCACATCCAGG - Intergenic
1017226693 6:152029756-152029778 GCAGGCCAACATTCACATTCAGG + Intronic
1018526939 6:164722954-164722976 GCAGCCAAACAGCCTCATGATGG - Intergenic
1018907670 6:168084883-168084905 GCAACCAAACAGCCACAGCAGGG + Intergenic
1019087046 6:169488278-169488300 GCACACAAACAGGCAGATCCTGG - Intronic
1019164336 6:170088230-170088252 CCAGCCCCACAGTCACACCCAGG - Intergenic
1019340503 7:506790-506812 GCTGCCGGTCAGTCACATCCTGG + Intronic
1019585869 7:1803174-1803196 GCAGCCCAACAGTCAGAGACAGG + Intergenic
1019912144 7:4107092-4107114 GCAGCCGAATACACACATCCAGG + Intronic
1020845158 7:13273215-13273237 GCAGGCCAACATTCACATTCAGG - Intergenic
1020939495 7:14513489-14513511 ACAGTCAAACAGTCTCATTCTGG + Intronic
1021369312 7:19821669-19821691 GCAGTCAATCAGTCAGGTCCTGG + Intergenic
1021571617 7:22071800-22071822 GCAGCAAATCATTCACATACTGG + Intergenic
1022867143 7:34432940-34432962 GCAGGCAAACATTCAAATACAGG + Intergenic
1022880108 7:34577398-34577420 GCAGGCAAACATTCAAATTCAGG + Intergenic
1024704573 7:51942866-51942888 GCAGGCCAACATTCACATTCAGG + Intergenic
1026181322 7:68043617-68043639 GCACCCTCACAGACACATCCAGG - Intergenic
1027225723 7:76242672-76242694 GCAGCTAGACAGTCCCATCTGGG + Intronic
1028724282 7:94070008-94070030 GAAGCCAGACAATCACAACCTGG - Intergenic
1029141511 7:98414083-98414105 GCAGCAAAACAGACACATTCTGG + Intergenic
1029432995 7:100544207-100544229 GGACCCAAACAGCCACATCAAGG - Intronic
1029542652 7:101193299-101193321 GCATCCAACCAGTCACAATCCGG - Intergenic
1029916148 7:104211337-104211359 GCAGGCCAACATTCACATTCAGG + Intergenic
1029922304 7:104278139-104278161 GCAGGCCAACATTCACATTCAGG + Intergenic
1030368092 7:108669331-108669353 ACACCCAAACAGACACACCCAGG - Intergenic
1031751732 7:125583162-125583184 ACACCCACACAGACACATCCAGG + Intergenic
1032795418 7:135272209-135272231 TCAGCCAAACTCTCACCTCCTGG - Intergenic
1033484390 7:141774467-141774489 GCAGGCCAACATTCACATTCAGG - Intronic
1035008647 7:155690994-155691016 GCAGGCCAACATTCACATTCAGG - Intronic
1035139467 7:156743528-156743550 GCAGCTCAACAGTGACATCAAGG + Intronic
1035182990 7:157104381-157104403 GCAGGCCAACATTCACATTCAGG - Intergenic
1035882090 8:3254401-3254423 GCAGGCCAACATTCACATTCAGG - Intronic
1036128924 8:6090299-6090321 GCAGGCAAACATTCAGATTCAGG - Intergenic
1037748568 8:21665143-21665165 GCACCCTCACAGACACATCCAGG - Intergenic
1040062089 8:43112529-43112551 GCAGGCCAACATTCACATTCAGG + Intronic
1040084402 8:43324958-43324980 GCAGGCCAACATTCACATTCAGG - Intergenic
1040090644 8:43395585-43395607 GCAGGCCAACATTCACATTCAGG - Intergenic
1040099147 8:43481659-43481681 GCAGGCCAACATTCACATTCAGG + Intergenic
1040099849 8:43489341-43489363 GCAGGCCAACATTCACATTCAGG + Intergenic
1040383506 8:46895564-46895586 GCAGGCCAACAGTCAAATTCAGG + Intergenic
1040539334 8:48338456-48338478 GCAGGCCAACATTCACATTCAGG - Intergenic
1040608403 8:48958420-48958442 GCAGGCCAACATTCACATTCAGG - Intergenic
1041486808 8:58386686-58386708 GCACCCAGACGGTCACATCAAGG + Intergenic
1042575100 8:70209225-70209247 GCAGCAATTCAGTCACATCTTGG - Intronic
1042620564 8:70699709-70699731 GCAGGCCAACATTCACATACAGG - Intronic
1042624265 8:70739994-70740016 GCAGGCCAACATTCACATACAGG - Intronic
1042638458 8:70905147-70905169 GCAGGCAAACATTCAAATTCAGG - Intergenic
1042713529 8:71746004-71746026 GCAGGCCAACATTCACATTCAGG - Intergenic
1043200636 8:77365161-77365183 GCAGGCAAACATTCAAATTCAGG + Intergenic
1043733193 8:83711384-83711406 GCACCCTCACAGACACATCCAGG + Intergenic
1045157317 8:99491387-99491409 GCAGGCCAACATTCAAATCCAGG - Intronic
1045928221 8:107595801-107595823 GCAGGCCAACATTCACATACAGG - Intergenic
1046331446 8:112720646-112720668 TGAGCCAATCAGTCACATCCTGG - Intronic
1046338733 8:112824830-112824852 GCAGCCCAACATTCAGATTCAGG - Intronic
1046900946 8:119522621-119522643 GCAGGCCAACATTCACATTCAGG + Intergenic
1047625677 8:126653655-126653677 GCAGCCACACAGTAGCATCAAGG + Intergenic
1048387684 8:133927808-133927830 GCAACTAGACAGTCACATCTGGG + Intergenic
1048594425 8:135851860-135851882 GCAGGCAAACATTCAGATTCAGG - Intergenic
1049053288 8:140215796-140215818 GCACCCAAACAGTCCCTGCCCGG + Intronic
1049767476 8:144361623-144361645 GCAGGCAAACAGTCACTCCAGGG - Intergenic
1050011034 9:1186131-1186153 GCAGGCCAACATTCACATTCGGG - Intergenic
1050178848 9:2898575-2898597 GCAGGCCAACATTCACATTCAGG - Intergenic
1050381318 9:5033355-5033377 GCAGGCAAACATTCAAATTCAGG + Intronic
1051505851 9:17826806-17826828 GCACCCACACAGACACACCCAGG + Intergenic
1051702086 9:19834690-19834712 GCAGGCCAACATTCACATTCAGG + Intergenic
1051727658 9:20104314-20104336 GCAGGCCAACATTCACATTCAGG + Intergenic
1052140901 9:24981868-24981890 GCAGCCACACTGACACTTCCTGG + Intergenic
1052165169 9:25317708-25317730 GCAGGCAAACATTCAAATTCAGG - Intergenic
1052300752 9:26949853-26949875 GCAGACCAACAGACACAACCTGG - Intronic
1053041793 9:34879815-34879837 GCAGGCCAACATTCACATTCAGG + Intergenic
1053418707 9:37963243-37963265 GCAGCCAGACAGTCAGAGCTTGG - Intronic
1053791397 9:41688707-41688729 GCAGCCAAACAGTGACTGACAGG + Intergenic
1054179746 9:61900400-61900422 GCAGCCAAACAGTGACTGACAGG + Intergenic
1054473544 9:65557183-65557205 GCAGCCAAACAGTGACTGACAGG - Intergenic
1054657795 9:67680420-67680442 GCAGCCAAACAGTGACTGACAGG - Intergenic
1055014149 9:71597427-71597449 GCAGGCCAACATTCACATTCAGG + Intergenic
1055750370 9:79499082-79499104 GCAGGCAAACATTCAGATTCAGG - Intergenic
1055754675 9:79545169-79545191 GCAGGCAAACATTCAAATTCAGG + Intergenic
1057077791 9:92147952-92147974 GCAGCCATACAATCCCGTCCTGG - Intergenic
1057214157 9:93218911-93218933 AGAGCCAACCTGTCACATCCAGG - Intronic
1058517282 9:105789603-105789625 GCAGGCCAACATTCACATTCAGG - Intergenic
1058615112 9:106818033-106818055 GCAGCTAGACAGTCCCATCTGGG + Intergenic
1059545599 9:115172990-115173012 GCAGGCAGACAGTAACTTCCAGG - Intronic
1059868028 9:118538385-118538407 GCATCCTCACAGACACATCCAGG + Intergenic
1059930716 9:119257913-119257935 GCTGAGAAACAGCCACATCCAGG + Intronic
1060268013 9:122123400-122123422 GCAGCCCCACAGCCATATCCGGG + Intergenic
1203758090 Un_GL000218v1:154914-154936 GCAGGCCAACATTCACATTCAGG - Intergenic
1203370911 Un_KI270442v1:303592-303614 GCAGGCCAACATTCACATTCAGG + Intergenic
1185836937 X:3353399-3353421 GCAGCTAGACAGTCCCATCTGGG + Intergenic
1185857910 X:3553097-3553119 ACACCCACACAGTAACATCCAGG - Intergenic
1187211275 X:17234548-17234570 GCAGGCCAACATTCACATTCAGG - Intergenic
1187590769 X:20714636-20714658 GCAACAAAAGAGCCACATCCTGG - Intergenic
1187595952 X:20772778-20772800 GCAGGCCAACATTCACATTCAGG + Intergenic
1188645487 X:32561624-32561646 CCAGCCAAACATTCAAATTCAGG + Intronic
1188978481 X:36704724-36704746 GCAGGCCAACATTCACATTCAGG - Intergenic
1189618928 X:42815200-42815222 GCAGGCCAACATTCAAATCCAGG - Intergenic
1189963724 X:46350526-46350548 GCAGGCACACAGTGACAACCTGG - Intergenic
1191049524 X:56176629-56176651 GCAGGCAAACATTCAAATTCAGG - Intergenic
1191158092 X:57297068-57297090 GCAGGCCAACATTCAGATCCAGG + Intronic
1191203453 X:57809548-57809570 GCAGGCCAACATTCAGATCCAGG - Intergenic
1191588974 X:62859684-62859706 GCAGGCAAACATTCAAATTCAGG + Intergenic
1191589767 X:62869743-62869765 GCAGGCAAACATTCAAATTCAGG - Intergenic
1191744922 X:64476477-64476499 GCAGGCAAACATTCAAATTCAGG - Intergenic
1191751525 X:64548312-64548334 GCAGGCAAACATTCAGATTCAGG - Intergenic
1191935409 X:66422528-66422550 GCAGGCCAACATTCACATTCAGG - Intergenic
1191938842 X:66455439-66455461 GCAGACCAACATTCACATTCAGG + Intergenic
1192097354 X:68226345-68226367 GCAGGCCAACATTCACATTCAGG + Intronic
1192101199 X:68266143-68266165 GCAGGCCAACATTCACATTCAGG + Intronic
1192802382 X:74479010-74479032 GCAGGCCAACATTCACATTCAGG - Intronic
1193040299 X:76997479-76997501 ACAGGCAAACAGTCAAATTCAGG - Intergenic
1193189284 X:78550262-78550284 GCAGGCCAACATTCACATTCAGG + Intergenic
1193765271 X:85521125-85521147 CCAGGCATACAGTCACATCAGGG + Intergenic
1194206442 X:91016708-91016730 ACACCCACACAGACACATCCAGG - Intergenic
1194233150 X:91348764-91348786 GCACCCTCACAGACACATCCAGG - Intergenic
1194370198 X:93061782-93061804 GCAGGCCAACATTCACATTCAGG + Intergenic
1194443821 X:93963514-93963536 ACACCCACACAGACACATCCAGG - Intergenic
1195045585 X:101051863-101051885 GCGGGGAAACAGTCACTTCCTGG + Exonic
1195572171 X:106408618-106408640 GCAGGCCAACATTCACATTCAGG + Intergenic
1196050681 X:111300559-111300581 ACTGCCAAACAGTAACCTCCAGG - Exonic
1197057809 X:122141607-122141629 GCAGGCCAACATTCACATTCAGG + Intergenic
1197708739 X:129651871-129651893 GCAGACAAAGAGACACATGCAGG - Intronic
1197916820 X:131544488-131544510 GCAACCAAGCAGACACATACTGG - Exonic
1198067361 X:133111979-133112001 GCAGGCCAACATTCACATTCAGG + Intergenic
1198474349 X:136981649-136981671 GCAGGCAAACATTCAAATTCAGG - Intergenic
1200318667 X:155161948-155161970 GCAGGCCAACATTCACATTCAGG - Intergenic
1200552194 Y:4591529-4591551 ACACCCACACAGACACATCCAGG - Intergenic
1201067423 Y:10111480-10111502 GCAGGCCAACATTCACATTCAGG - Intergenic
1201600800 Y:15726846-15726868 GCAGGCCAACATTCACATTCAGG - Intergenic
1202070190 Y:20984197-20984219 GCAGGCTAACATTCACATTCAGG - Intergenic
1202100008 Y:21297674-21297696 GCACCCTTACAGACACATCCAGG - Intergenic