ID: 968179529

View in Genome Browser
Species Human (GRCh38)
Location 3:196581652-196581674
Sequence ATCCAAGTGGTCCTAAGTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 69
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 64}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968179529 Original CRISPR ATCCAAGTGGTCCTAAGTGT TGG (reversed) Intronic
905902576 1:41591404-41591426 AGCCAAGTGGTCCTAGCAGTGGG + Intronic
912551867 1:110490028-110490050 CTCCCTGTGGTCCTAGGTGTAGG + Intergenic
918810592 1:189114188-189114210 AACCAAGTGATCATAAATGTGGG + Intergenic
919235772 1:194840165-194840187 ATTCAAGTGCACCTAGGTGTTGG + Intergenic
921057848 1:211557515-211557537 TCCCATGTGGTCCTAAGGGTAGG - Intergenic
1069325130 10:67224394-67224416 ATCCAAGTTGTCATAAGTGGTGG + Intronic
1069533118 10:69233508-69233530 ATGTCAGTGGTCCTAAGTGCAGG - Intronic
1070065343 10:73027985-73028007 ATACATGTGGTGCTAAATGTTGG - Intronic
1071605163 10:86980753-86980775 CTCCAAGATGCCCTAAGTGTAGG - Intronic
1072440995 10:95455046-95455068 ATCCAAGTTATACTAAGTCTAGG - Intronic
1074893831 10:117757668-117757690 ATGCATTTGGTCCAAAGTGTGGG + Intergenic
1076006759 10:126953950-126953972 TTCCGAGTGGTCCTGTGTGTTGG + Intronic
1078167198 11:8897895-8897917 ATGCCTGTGGTCCTAACTGTGGG - Intronic
1087856563 11:103098854-103098876 ATGCATCTGGTCCTAAGTATAGG - Intergenic
1090434440 11:126675081-126675103 ATCGAAGAGGCCCTAAGAGTGGG - Intronic
1097147748 12:56953418-56953440 AGCCCAGTGGTTGTAAGTGTGGG - Intronic
1102359266 12:112269578-112269600 ATCCATGAGGTCCCAATTGTGGG + Intronic
1102584871 12:113915677-113915699 ATCGCAGAGATCCTAAGTGTCGG - Intronic
1103072657 12:117957559-117957581 ACCCATGTGGTCCCAACTGTTGG - Intronic
1104303517 12:127588348-127588370 ATCCAGCTGGACCTAAGTCTGGG - Intergenic
1106243306 13:27926939-27926961 AGCAAAGTGGTCCTAGGGGTTGG - Intergenic
1108888039 13:55214449-55214471 ATTCAAATGGTCTTAAGAGTGGG - Intergenic
1111399879 13:87720749-87720771 ATCCACGAAGTCGTAAGTGTGGG + Intergenic
1128869723 15:71144878-71144900 GTCCATGTGGACCAAAGTGTAGG + Intronic
1133677508 16:8088971-8088993 AGCCAAGTGGTCCAGAATGTGGG - Intergenic
1139496363 16:67322093-67322115 ATTCAATTGATCATAAGTGTAGG - Intronic
1139731377 16:68948576-68948598 TTCCTAGTGGTCTTAAGTATAGG + Intronic
1143309681 17:5978070-5978092 ACCCAAGTGGTCCCAGCTGTGGG + Intronic
1149971318 17:61221131-61221153 ATCCCAGTGTTACAAAGTGTCGG + Intronic
1161693215 19:5749737-5749759 CTCAAAGTGGTACTAAGTGGTGG + Intronic
926778905 2:16449024-16449046 GTCCAGTTGGTTCTAAGTGTGGG - Intergenic
928584357 2:32743431-32743453 ATCCTAGTGGTGCTTAGGGTAGG + Intronic
930374651 2:50550322-50550344 GCTCAAGTGATCCTAAGTGTGGG + Intronic
932406574 2:71516690-71516712 AGCCTAGTGGCTCTAAGTGTAGG + Intronic
948305816 2:236945987-236946009 ATCCATGTGGACCGAAGTGCAGG + Intergenic
1175463963 20:59177041-59177063 TTCCAAGTGGCCCTCAGTGGTGG + Intergenic
1177307261 21:19335014-19335036 ATCCCAGTGGACTTAAGTGGTGG + Intergenic
1177855849 21:26399444-26399466 CTCCAAGCTGTCGTAAGTGTGGG - Intergenic
1181810638 22:25401803-25401825 ATCCAAGTAGTCCCAGGTATGGG - Intronic
1185061339 22:48608475-48608497 ATCCACGTGGCCCCAAGTGGAGG - Intronic
953089502 3:39709957-39709979 ATCCAAATGGTCATAAAAGTTGG - Intergenic
966046275 3:175554148-175554170 AACCAAGTAGTCCTAAGTGGAGG + Intronic
968179529 3:196581652-196581674 ATCCAAGTGGTCCTAAGTGTTGG - Intronic
974886007 4:67817863-67817885 ATCCAAGTTGACTTAAGTTTTGG - Intergenic
986174825 5:5343125-5343147 TTCCATGTAGTCTTAAGTGTTGG - Intergenic
986744700 5:10733483-10733505 ATCCAGGTGCTCCTAAATGGAGG - Intronic
991958867 5:72021789-72021811 ATCCAGGTTCTGCTAAGTGTGGG - Intergenic
995063719 5:107838321-107838343 ATTCAGGTGGTCCAAAGGGTGGG - Intergenic
1003410439 6:5857164-5857186 ATCCATGTGGTAGTATGTGTTGG + Intergenic
1004208350 6:13613607-13613629 ATCCCAGTGGTCCTTTGTGTAGG + Exonic
1004742057 6:18471676-18471698 GTCAAAGTGCTTCTAAGTGTTGG + Intergenic
1009468014 6:63997444-63997466 ATTCAAGTGCTCCTAAGCCTGGG - Intronic
1019612485 7:1943989-1944011 ACCCATGTGGTCATAGGTGTCGG - Intronic
1021824219 7:24531888-24531910 ATGCAACAGGTTCTAAGTGTTGG - Intergenic
1022130032 7:27396634-27396656 ATAGCAGTGGTCCTCAGTGTTGG - Intergenic
1027884549 7:83887390-83887412 ATCCACGTTGTCCCAAGTGATGG + Intergenic
1028087588 7:86655333-86655355 ATCCATGTGGTCCTTACTGTAGG + Intronic
1028133127 7:87200335-87200357 AACAAAGTGGTCCTAAGTTCAGG - Intronic
1030784469 7:113642503-113642525 AAAAAAGTGATCCTAAGTGTTGG + Intergenic
1030983327 7:116211000-116211022 ATCCCAGTGGTTGTAGGTGTTGG + Intronic
1035481779 7:159192699-159192721 TCCCAAGTGGTCCTTAATGTGGG + Intergenic
1037539071 8:19854816-19854838 ATCCAGATGGACCTAAGCGTAGG - Intergenic
1047502434 8:125452542-125452564 CTCTAAGTGGTCCTTAGTGGGGG - Intergenic
1047995119 8:130327346-130327368 CTCCAACTGGACCTCAGTGTAGG + Intronic
1186615913 X:11187794-11187816 ATTCAAGTGATCCAAAGTGCTGG - Intronic
1186836033 X:13439057-13439079 ATCCAAGTGCTCCCAAGTCAAGG - Intergenic
1189675649 X:43458035-43458057 ATCCAAGTGGTTTTAAGGATTGG - Intergenic
1198685379 X:139222965-139222987 TTCCAACTTGTTCTAAGTGTAGG + Intergenic
1199102565 X:143820586-143820608 ATCAAAGTTGTCTTATGTGTTGG - Intergenic