ID: 968186375

View in Genome Browser
Species Human (GRCh38)
Location 3:196635710-196635732
Sequence CAAAGAAAGGAGGAGGAGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968186375_968186384 28 Left 968186375 3:196635710-196635732 CCGGCCTCCTCCTCCTTTCTTTG No data
Right 968186384 3:196635761-196635783 GCATAAGATAGTATATTTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968186375 Original CRISPR CAAAGAAAGGAGGAGGAGGC CGG (reversed) Intergenic
No off target data available for this crispr