ID: 968189839

View in Genome Browser
Species Human (GRCh38)
Location 3:196659844-196659866
Sequence GATTCCACAGGGTCTTGAGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 158}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968189839_968189845 4 Left 968189839 3:196659844-196659866 CCCTCTCAAGACCCTGTGGAATC 0: 1
1: 0
2: 0
3: 6
4: 158
Right 968189845 3:196659871-196659893 CCTCCAGCCTTACCCTCTCCTGG 0: 1
1: 0
2: 3
3: 56
4: 689

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968189839 Original CRISPR GATTCCACAGGGTCTTGAGA GGG (reversed) Exonic
902916447 1:19642966-19642988 GCTCCCAGAGGGTCTTGGGAAGG + Intronic
902916468 1:19643110-19643132 GCTCCCAAAGGGTCTTGGGAAGG + Intronic
902919385 1:19657150-19657172 CATTCCACAGGGGGATGAGAGGG - Exonic
903737638 1:25540474-25540496 GATTCAAGAGGGGCTTGAAAGGG - Intergenic
904055871 1:27669473-27669495 GATTCCCGAGGCTCCTGAGAGGG - Intronic
911460819 1:98187920-98187942 GATTTAAGAGGATCTTGAGAAGG - Intergenic
911739368 1:101370207-101370229 GATTACACAAGGCCTTAAGAGGG - Intergenic
912431692 1:109631444-109631466 GTGTCCACAGGGGCTTGGGATGG + Exonic
915397396 1:155595832-155595854 GATTTCCTAGGGTCTGGAGAGGG + Intergenic
915413017 1:155717758-155717780 GATTTCCTAGGGTCTGGAGAGGG + Intronic
916748209 1:167700738-167700760 GATTCCACCAGGTCTAGAGAAGG + Intronic
917809554 1:178644883-178644905 GATTCCACAGTTTGTTGACATGG - Intergenic
920346050 1:205306378-205306400 GTTTCCCCAGGGTCTGGAGAAGG - Intronic
924628877 1:245718462-245718484 GATTTCACTGTGCCTTGAGATGG + Intergenic
1068260759 10:54577944-54577966 AATTCGACATGGTCTTAAGAAGG - Intronic
1068580023 10:58729608-58729630 GATTCCACAGGTTTTACAGAAGG + Intronic
1072919316 10:99562579-99562601 GATTCCACAGGTTTGTGATAAGG + Intergenic
1074313631 10:112343256-112343278 GATTGCACAAGGTCAGGAGAGGG + Intergenic
1077874257 11:6290403-6290425 GAATTCAGAGGGTCCTGAGAAGG - Intergenic
1079268130 11:18955918-18955940 GGTTCCTCAGGGTCTTCAAATGG - Intergenic
1080132401 11:28812296-28812318 GCATCCAAAGGATCTTGAGAGGG - Intergenic
1081431265 11:42979085-42979107 GATTTGAAAGGGTCTTGATATGG + Intergenic
1082006025 11:47419512-47419534 GATTTCACAGGGTCGTGGTAAGG - Intronic
1082190688 11:49239723-49239745 GATTCCACAGGTACATGAGATGG - Intergenic
1082235549 11:49817916-49817938 GAATCCGCAGGTTCTTGACACGG + Intergenic
1084574727 11:69981759-69981781 GTTTCCAAAGGGTCTTTGGAAGG - Intergenic
1086448682 11:86894461-86894483 AATTGCAAAGGGTCTTGAAATGG - Intronic
1086675434 11:89601194-89601216 GATTCCACAGGTACATGAGATGG + Intergenic
1087246234 11:95840924-95840946 CATTCAACAGGGTTTCGAGATGG + Intronic
1088784567 11:113169411-113169433 GCTGCCACAGGGTCAGGAGAAGG - Intronic
1091082696 11:132686665-132686687 CATTCCCCAGTGTCCTGAGAAGG + Intronic
1091159939 11:133411041-133411063 AATTCCTCAGGGTCCTGTGAGGG - Intronic
1092395888 12:8126136-8126158 GATCCCACACAGTCTTGAGCAGG - Intronic
1096026328 12:48366279-48366301 CCTTCCACAGAGTCTTCAGAGGG - Intergenic
1096041151 12:48518681-48518703 GATTCCATCTGGTCTTCAGAAGG + Intronic
1096413566 12:51393843-51393865 GAGTCCAGAGGGTCTACAGATGG - Intronic
1100885903 12:99069834-99069856 GATTCCACAGAGTACAGAGACGG + Intronic
1108905241 13:55462237-55462259 GGTTCCCCAGGGTCAAGAGATGG - Intergenic
1110355236 13:74559792-74559814 TCTTCCACAGAGTCTTCAGAGGG + Intergenic
1110918365 13:81052075-81052097 CTTTCCACAGGGTCAGGAGAGGG - Intergenic
1114424881 14:22613208-22613230 GAAGACACAGGGTCCTGAGATGG - Exonic
1114768923 14:25406880-25406902 GATACCCAATGGTCTTGAGAAGG + Intergenic
1120305745 14:82767427-82767449 GATCCCACAAAGTCTGGAGAGGG - Intergenic
1123921884 15:25076029-25076051 GCTTCAACAGGGGCTAGAGATGG + Intergenic
1127455794 15:59155038-59155060 GCTCCCACAGGGTCTGGGGATGG + Intronic
1129196383 15:73969683-73969705 GTTTCCACAGGGTCTGGCCATGG + Intergenic
1130168413 15:81486324-81486346 GGATCCACAGGGTGTTGGGAGGG + Intergenic
1130895344 15:88166163-88166185 GATTCCAAAGGATCCTGAGCAGG - Intronic
1131343860 15:91627971-91627993 TCTTCCACAAGGTTTTGAGAAGG - Intergenic
1132644999 16:994734-994756 GTTTCCACTGAGTCTTGAGCAGG + Intergenic
1133386282 16:5372824-5372846 GATTCCAAAGGATCATGAGATGG - Intergenic
1133437812 16:5794957-5794979 CATCTCACTGGGTCTTGAGAAGG + Intergenic
1134327720 16:13222203-13222225 GATTCCCAAGTGTCTTGGGAGGG - Intronic
1134374986 16:13663786-13663808 GGTTCCAGAGAGTCTTCAGAAGG - Intergenic
1137714681 16:50591517-50591539 GACTCCACAGGCTCAGGAGAGGG - Intronic
1138231892 16:55343876-55343898 GATTCCACAGGGAGCTGGGATGG - Intergenic
1142264879 16:89059093-89059115 GATTCCACACATTCATGAGATGG - Intergenic
1142328497 16:89434207-89434229 GAATCCATAGTGTCTTGAGGAGG - Intronic
1143699591 17:8648291-8648313 GATTCCACAGGCTCATCTGAAGG - Intergenic
1143992927 17:10981896-10981918 GAGCCCACAGAGTCTAGAGATGG - Intergenic
1144016347 17:11199998-11200020 GAGTCCACAAGGGCTTCAGATGG + Intergenic
1149983051 17:61326587-61326609 GATTCCACAGGGCTTTGTTACGG + Intronic
1151702869 17:75752632-75752654 GAGTCCACTGGGTCCAGAGAGGG + Intronic
1151997616 17:77620065-77620087 GATTCATCAGGGTCTGGGGAAGG + Intergenic
1152468726 17:80478989-80479011 GCTTGCCCAGGGTCTTGTGAAGG - Intergenic
1153233266 18:2961192-2961214 GGTTCCAAAGGGTCTTGGGCAGG - Intronic
1155349137 18:24889302-24889324 GAGTCCACAGTGGATTGAGAAGG + Intergenic
1157313418 18:46569411-46569433 GATGTCACATGGTCTTGGGAAGG + Intronic
1157313859 18:46572406-46572428 GATGTCACATGGTCTTGGGAAGG + Intronic
1158792299 18:60796408-60796430 AATTCCACATGGTCTTGATTAGG - Intergenic
1158839796 18:61373022-61373044 GAGCCCACAGAGTCTAGAGATGG - Intronic
1159115093 18:64104889-64104911 AATTCCACAGGGCCTGGAGGAGG - Intergenic
1160298417 18:77657950-77657972 GATTCCACGGGGGCTTGTGGTGG + Intergenic
1160326563 18:77955060-77955082 CTTGCCCCAGGGTCTTGAGAGGG + Intergenic
1162838162 19:13335296-13335318 GATACCTCATGGTCTTAAGATGG - Intronic
1163603571 19:18262434-18262456 GTTACCCCAGGGGCTTGAGATGG + Intronic
1164151690 19:22559118-22559140 GATTCCATAGTGTCTTGCAATGG + Intergenic
1165091955 19:33392356-33392378 GATTCCACAGAGTCCGGGGATGG - Intronic
1168182499 19:54671828-54671850 GACTCCACAGGGTCCTGTCATGG + Intronic
1168526652 19:57093947-57093969 GATTCTACAGGGCGTTGCGAAGG - Intergenic
925821653 2:7804999-7805021 TCTTCCACAAGGTGTTGAGAAGG + Intergenic
927356726 2:22182023-22182045 GACTCCTCAGAGTCTTGAGGTGG + Intergenic
928089012 2:28362918-28362940 GCTTCCGCAGGGTCTGGAGATGG - Intergenic
929396593 2:41530935-41530957 GATTCCACAGATTCTGGAGCTGG - Intergenic
931959941 2:67471027-67471049 GATTCCACAGCAGCTTCAGAAGG - Intergenic
932756681 2:74414583-74414605 GCCTCCACAGGGTCTGGAGCTGG - Exonic
933279112 2:80313008-80313030 GATTCCACAGGCTATTGATTAGG - Intronic
937152717 2:119696876-119696898 GATTGTATAGGGTCTTGTGAAGG + Intergenic
938952447 2:136267368-136267390 GATTCCTCAGCCCCTTGAGAAGG - Intergenic
940904194 2:159154003-159154025 AATTACACAGGGCCTGGAGAAGG + Intronic
940949883 2:159661586-159661608 GATTGCACTGGGTTTTGACATGG - Intergenic
941235280 2:162964056-162964078 GATTTCCCAGGCTCTTCAGATGG + Intergenic
945200337 2:207274922-207274944 GATTCCACACGGTCCTAAGGAGG + Intergenic
948192893 2:236073810-236073832 GATTCTAAAGTGTGTTGAGAAGG - Intronic
1170444630 20:16413242-16413264 AATTCCAGAGAGTCTTCAGAGGG + Intronic
1171125747 20:22600495-22600517 AATTCCAAAGAGTCTTGTGATGG - Intergenic
1173451780 20:43171052-43171074 AATTTCACAGGGTCTTGACGTGG + Intronic
1177087403 21:16723867-16723889 TATTCCACAGGGTCAGGAAAGGG - Intergenic
1178405040 21:32316855-32316877 GAGTCCACAGGCTCCTGAGTGGG + Exonic
1178413736 21:32387121-32387143 GAATCCTCAGGCTGTTGAGAGGG - Intronic
1179675832 21:42981493-42981515 CATGCCTCAGGGACTTGAGAAGG + Intronic
1180052632 21:45338751-45338773 AATAGCACAGGGTCTTGTGACGG + Intergenic
1183828149 22:40404471-40404493 GGACCCACAGGGTGTTGAGAGGG + Intronic
951308541 3:21096583-21096605 GACTCCACTGGGACTTGGGATGG - Intergenic
956743644 3:72294278-72294300 GATTCTACAGAGTCCTGAGGTGG - Intergenic
958118281 3:89250951-89250973 AATTACACAGCCTCTTGAGAAGG - Intronic
959598445 3:108152761-108152783 GCTTTCACAGTGTATTGAGAAGG - Intergenic
960865413 3:122194581-122194603 GGTTCCACAATGTCATGAGAAGG + Intronic
961085196 3:124061088-124061110 AGTTGCACAGGGTCTTCAGAAGG - Intergenic
962807758 3:138939062-138939084 GATTCCACAGGGCCCTGACCCGG + Intergenic
963394572 3:144715433-144715455 AATTCCACTTGGTCTTGAGCCGG - Intergenic
963895672 3:150682990-150683012 GATTGCACAGGCTCCTGAGCAGG + Intronic
968189839 3:196659844-196659866 GATTCCACAGGGTCTTGAGAGGG - Exonic
970669054 4:18375151-18375173 GACTCTGCAGGGTCCTGAGATGG - Intergenic
971152504 4:24048561-24048583 GATTTCATAGGGTCTTGCCAGGG - Intergenic
972796456 4:42425841-42425863 GGTTTCACAGTGCCTTGAGAAGG - Intronic
979715501 4:123832517-123832539 GATTCCACAGGGCCTAGATGAGG + Intergenic
981572397 4:146166557-146166579 TATTCCACTGGGTATTGATATGG + Intergenic
981752431 4:148105317-148105339 GATTCAATATAGTCTTGAGAAGG - Intronic
982126551 4:152188818-152188840 GGTTCACCAGAGTCTTGAGAAGG + Intergenic
983824985 4:172248652-172248674 AATTCCCAAGGGTCCTGAGAGGG + Intronic
985627783 5:998878-998900 GATTCCACTGTGTGTTTAGAAGG - Intergenic
986019975 5:3792072-3792094 GATTTCAGAGAGACTTGAGAGGG + Intergenic
988551468 5:32204542-32204564 GAATCCAAAGGGTCTTGTGCAGG - Intergenic
993352850 5:86871049-86871071 AGTTCCACTGGGTATTGAGAAGG - Intergenic
995949970 5:117699742-117699764 ACTTCCACAGGGGCTAGAGAGGG - Intergenic
998098475 5:139412139-139412161 CATTCCACAGAGTCAGGAGATGG - Exonic
1000669012 5:164036831-164036853 CATTCTACTGGGTCTTGGGAAGG + Intergenic
1001486349 5:172122354-172122376 GATTACACAGGGACTGGAAACGG - Intronic
1001685490 5:173591725-173591747 AATTCAACAGAGTATTGAGATGG + Intergenic
1003088339 6:3079590-3079612 GATTGCACAGGGTATGGGGAGGG + Intronic
1003306619 6:4934789-4934811 GTTTTGCCAGGGTCTTGAGATGG - Intronic
1010928389 6:81770974-81770996 GATACCACAGGGAAATGAGAAGG + Intergenic
1011339104 6:86292808-86292830 GATTCCCCAGTGTTTTGTGATGG + Intergenic
1013053606 6:106561512-106561534 GATTCCACGGGGGCCTGTGATGG + Intronic
1013086167 6:106859667-106859689 ATTTCCACAGGGTCTTCATATGG - Intergenic
1014201089 6:118609588-118609610 CATTTCACTGGGTCTTGAAAGGG - Intronic
1016204043 6:141451663-141451685 GATTCTACACTGTCTTTAGAAGG - Intergenic
1017135607 6:151144671-151144693 TTTTACAGAGGGTCTTGAGAAGG - Intergenic
1024566103 7:50682146-50682168 GAATCCAGAGACTCTTGAGAAGG + Intronic
1026108841 7:67442480-67442502 TTTTCTACAGGGTCCTGAGATGG - Intergenic
1030185732 7:106759924-106759946 GTTTCCACAGGGGCGGGAGAAGG + Intergenic
1033152986 7:138932768-138932790 GACTCCGTAGGGTCTTGAGTGGG - Intronic
1034320237 7:150173310-150173332 GCTTCCACATGGTGTTGAGCCGG - Intergenic
1037948857 8:23006011-23006033 GGTACCACATGGTCTTGACATGG - Exonic
1038809826 8:30829056-30829078 GATTCCAGAGGCATTTGAGAAGG - Intergenic
1040454756 8:47585706-47585728 GACTCTGCAGAGTCTTGAGATGG + Intronic
1046629538 8:116609556-116609578 TGTTCTATAGGGTCTTGAGATGG - Intergenic
1049457940 8:142703475-142703497 GACTTCCCAGGGTCTTGGGATGG + Exonic
1051397872 9:16645998-16646020 CATTCCACAGGGTTCTGAAAAGG + Intronic
1052690205 9:31808033-31808055 GATTCCACAGGGCCAACAGAGGG - Intergenic
1052765047 9:32632638-32632660 GATCCCACAGGGTGTGGTGAAGG - Exonic
1055312308 9:74995346-74995368 GATTCCACAAGGTATTTATAAGG + Intronic
1058115062 9:101076034-101076056 GATTGGACAGGGACTTGAGCAGG + Intronic
1058643621 9:107110252-107110274 GACTGCACAGGGTCTGGAGCAGG - Intergenic
1059331504 9:113538527-113538549 GATTCTCCAAGGTATTGAGAAGG - Intronic
1061771099 9:132922581-132922603 GTTTCCACAGGGTCTAGGTAAGG - Intronic
1061877826 9:133553799-133553821 GCTGCCCCAGGGTCTTGACAGGG + Intronic
1062003521 9:134228391-134228413 GATGCCACTGGGTCCTGGGAGGG + Intergenic
1185477420 X:423758-423780 GAATTCACGGGGTGTTGAGATGG - Intergenic
1189681433 X:43520378-43520400 GATTTCTCAGTGCCTTGAGAAGG + Intergenic
1195021935 X:100837428-100837450 CACTCCACAGGATCATGAGAAGG + Exonic
1200032671 X:153309128-153309150 CATTCCACAGAGCCTTCAGAGGG - Intergenic
1201148019 Y:11076867-11076889 TATTCCCCAGAATCTTGAGAAGG - Intergenic
1201366929 Y:13217321-13217343 GGTTCAACAGGGAATTGAGAAGG + Intergenic