ID: 968190041

View in Genome Browser
Species Human (GRCh38)
Location 3:196660879-196660901
Sequence CAGGGGGGACGCCCAGGAGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 362
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 335}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968190041_968190049 -3 Left 968190041 3:196660879-196660901 CCAGCTCCTGGGCGTCCCCCCTG 0: 1
1: 0
2: 1
3: 25
4: 335
Right 968190049 3:196660899-196660921 CTGGCCTCTTCGCCAATGCTAGG 0: 1
1: 0
2: 1
3: 10
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968190041 Original CRISPR CAGGGGGGACGCCCAGGAGC TGG (reversed) Exonic