ID: 968199559

View in Genome Browser
Species Human (GRCh38)
Location 3:196740264-196740286
Sequence GCGGCTCCCCGGCCCCGCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 412
Summary {0: 1, 1: 0, 2: 5, 3: 39, 4: 367}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968199559_968199571 15 Left 968199559 3:196740264-196740286 CCCGCGCGGGGCCGGGGAGCCGC 0: 1
1: 0
2: 5
3: 39
4: 367
Right 968199571 3:196740302-196740324 AGCCGCAGCTCCTGGGGCGGTGG 0: 1
1: 0
2: 3
3: 38
4: 431
968199559_968199567 7 Left 968199559 3:196740264-196740286 CCCGCGCGGGGCCGGGGAGCCGC 0: 1
1: 0
2: 5
3: 39
4: 367
Right 968199567 3:196740294-196740316 GTGCTGGGAGCCGCAGCTCCTGG 0: 1
1: 1
2: 7
3: 82
4: 494
968199559_968199568 8 Left 968199559 3:196740264-196740286 CCCGCGCGGGGCCGGGGAGCCGC 0: 1
1: 0
2: 5
3: 39
4: 367
Right 968199568 3:196740295-196740317 TGCTGGGAGCCGCAGCTCCTGGG 0: 1
1: 0
2: 1
3: 40
4: 497
968199559_968199563 -8 Left 968199559 3:196740264-196740286 CCCGCGCGGGGCCGGGGAGCCGC 0: 1
1: 0
2: 5
3: 39
4: 367
Right 968199563 3:196740279-196740301 GGAGCCGCCACCTGCGTGCTGGG 0: 1
1: 0
2: 1
3: 11
4: 106
968199559_968199570 12 Left 968199559 3:196740264-196740286 CCCGCGCGGGGCCGGGGAGCCGC 0: 1
1: 0
2: 5
3: 39
4: 367
Right 968199570 3:196740299-196740321 GGGAGCCGCAGCTCCTGGGGCGG 0: 1
1: 0
2: 6
3: 47
4: 782
968199559_968199562 -9 Left 968199559 3:196740264-196740286 CCCGCGCGGGGCCGGGGAGCCGC 0: 1
1: 0
2: 5
3: 39
4: 367
Right 968199562 3:196740278-196740300 GGGAGCCGCCACCTGCGTGCTGG 0: 1
1: 0
2: 2
3: 11
4: 168
968199559_968199569 9 Left 968199559 3:196740264-196740286 CCCGCGCGGGGCCGGGGAGCCGC 0: 1
1: 0
2: 5
3: 39
4: 367
Right 968199569 3:196740296-196740318 GCTGGGAGCCGCAGCTCCTGGGG 0: 1
1: 0
2: 4
3: 32
4: 357

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968199559 Original CRISPR GCGGCTCCCCGGCCCCGCGC GGG (reversed) Intronic
900427217 1:2586311-2586333 GCCGCTCCCCGGCGCCCCCCGGG + Intergenic
901525973 1:9823706-9823728 GCGCCGCCCCGCTCCCGCGCTGG - Exonic
901805615 1:11736593-11736615 GCGGCTCACCTCCCCCGCGCGGG + Intronic
901851619 1:12019617-12019639 GCGGCCCCCGAGCCCCTCGCGGG - Intronic
902169587 1:14599133-14599155 GCGGCTCCCGGGCCCGGGCCGGG - Exonic
902214243 1:14924455-14924477 GCGGGTCCCGGGGGCCGCGCGGG - Intronic
902471204 1:16648366-16648388 GCGTCTCAGCGGACCCGCGCTGG - Intergenic
902600878 1:17539662-17539684 GCGGCGCCCCGGGACCGGGCGGG + Intergenic
902796543 1:18804170-18804192 GCGCCTCCATGGCCCCACGCAGG + Intergenic
903070917 1:20726692-20726714 GCAGCTGCCCTGCCCCGCCCTGG - Intronic
903349922 1:22711210-22711232 GCCGCTCCCCGGGCGCCCGCGGG - Intronic
903455553 1:23484385-23484407 CCGCTTCCCCGGCCCCTCGCCGG + Intronic
903466372 1:23554941-23554963 GCGGCCCCCAGGGCCCGCGGGGG + Intergenic
903832899 1:26185107-26185129 GCGGCTTCATGGGCCCGCGCTGG + Exonic
903945595 1:26960321-26960343 GCGCCCCCCTGGGCCCGCGCCGG + Intronic
904143252 1:28369971-28369993 GCGGCGGCCCCGCCCCGCCCTGG - Intronic
904467800 1:30718531-30718553 GCTCCTCCCCGGCCCCGCCCCGG + Intronic
904654835 1:32036997-32037019 GCAGCTCCCCGGCCTCTCACTGG - Exonic
904784180 1:32973165-32973187 GCGGAATCCCGGCCCCTCGCCGG - Intergenic
904800963 1:33092750-33092772 TCGGCTCCCCGCCCCCGACCAGG - Intronic
905648269 1:39639685-39639707 GCCCCGCCCCGGCCCCGCCCCGG + Exonic
906044407 1:42817062-42817084 CCGGCCCCCCGACCCCGCCCCGG + Intronic
907450403 1:54542444-54542466 GCCCCTTCCCCGCCCCGCGCGGG + Intronic
908128346 1:61051138-61051160 CCGGCTCTCCGGCCGAGCGCCGG - Intronic
908534622 1:65066661-65066683 CCCGGTCCCCGGCGCCGCGCGGG + Intergenic
909392894 1:75136313-75136335 TCGGTTCCCCGCCCCCCCGCCGG - Intronic
910757233 1:90706641-90706663 GCGGCGCGCCGGCTCCGTGCGGG - Intergenic
911001437 1:93170336-93170358 TGGGCTCCGCGGCCCCGCACTGG + Intronic
911052418 1:93681877-93681899 GCGGCTCCGCGGCCCCACCCCGG + Intronic
911176137 1:94820312-94820334 GCCCCTCCCCGGCCCGGCCCCGG + Intergenic
912798618 1:112707220-112707242 GGCCCGCCCCGGCCCCGCGCAGG + Intronic
914803102 1:150974578-150974600 CCGGCGCCCGAGCCCCGCGCGGG - Intronic
915319981 1:155051265-155051287 GCGGCCACCAGGCCCCGCCCCGG - Exonic
920216211 1:204363132-204363154 GTGGCTCCCCCGCCCCTCCCAGG + Intronic
920674607 1:208030403-208030425 GAGCATCCCCGGCCCAGCGCTGG - Intronic
920805715 1:209231851-209231873 GCAGCGCCCGTGCCCCGCGCCGG + Intergenic
922279965 1:224114267-224114289 GGCGCTCCCAGCCCCCGCGCTGG + Exonic
922821408 1:228487922-228487944 GCGCCTCTCCGCCCCCGCCCCGG + Intronic
1064354310 10:14604046-14604068 GCACCTCCCGGGCGCCGCGCGGG + Intronic
1065099807 10:22321538-22321560 GCGGCTGCTCGGGGCCGCGCTGG + Exonic
1067019491 10:42782489-42782511 GCGGCTCTGCGGCCTGGCGCCGG - Intergenic
1067102480 10:43343047-43343069 GCCTCTCCCCGGCCTCGCCCCGG - Intergenic
1067111869 10:43407209-43407231 GCGGCTTCCCGGAACCGCGCGGG - Intronic
1067682754 10:48450884-48450906 CCGGCTCCCCGGCCCCGTGGGGG + Exonic
1067769941 10:49115636-49115658 GCGGCTCCCGCGCCCGGTGCGGG - Intergenic
1070140168 10:73732874-73732896 GGGGCTCCCCGCCCGCGCTCAGG - Intergenic
1071579456 10:86756474-86756496 GCGCCTGCCCCGCCCCGCCCCGG - Intergenic
1071579622 10:86757027-86757049 GGGGCTGCCCGGCCCGGCCCCGG + Intronic
1072249022 10:93567266-93567288 ACGGCTCCCCGGCGCCGACCAGG + Exonic
1072421179 10:95291280-95291302 GCGGCTCTCGGGCCCGGGGCGGG + Intergenic
1072783989 10:98268237-98268259 GCGGCCCCCCAGCCCCGAGCTGG + Exonic
1074126135 10:110530285-110530307 GCGGGTGCCCGGCCCTGCCCAGG - Intergenic
1075345437 10:121678727-121678749 GCTGCTCCCCAGCCCAGTGCTGG + Intergenic
1076554262 10:131311747-131311769 GCTCCGCCCCTGCCCCGCGCGGG + Intergenic
1076981817 11:208784-208806 GCAGTTCGCCGGCCCCGCCCTGG - Exonic
1077103661 11:832892-832914 GCCCCGCCCCGGCCCCGCCCCGG - Exonic
1077171519 11:1168419-1168441 GCGGCACCTCAGCCCCGCGGAGG - Intronic
1077250157 11:1557321-1557343 GGGGCTCCCCGCCCGCGCTCAGG + Exonic
1077500848 11:2909205-2909227 GCGCCGCCCGCGCCCCGCGCTGG - Exonic
1077550131 11:3196557-3196579 GCGGGTCCCTGGGCCCGGGCAGG + Intergenic
1078139671 11:8682953-8682975 GCCCCGCCCCGGGCCCGCGCCGG - Intronic
1079250144 11:18781140-18781162 GCACCCCCCCGGCCCCGCCCCGG + Intronic
1081700023 11:45146961-45146983 GCCGCTCCCGGCCCCCGCACCGG - Intronic
1081812520 11:45922037-45922059 GGGGATCCCCGGCCCTGCCCAGG + Intronic
1081973417 11:47215345-47215367 GAGGCTCCCGAGGCCCGCGCAGG + Intronic
1083342384 11:61967250-61967272 GCGGTTCCCGGGGCGCGCGCTGG - Intronic
1083872472 11:65497643-65497665 GCGGCTCGCGAGCGCCGCGCAGG - Intergenic
1083927601 11:65818023-65818045 GAGGCGCCCCGACACCGCGCCGG + Intergenic
1084014710 11:66371646-66371668 GCGGCCCTCCGCCCCAGCGCAGG - Exonic
1084019477 11:66409224-66409246 GGGACTCCCCGGCCCGGCGCGGG - Intergenic
1084524214 11:69685926-69685948 CCGAGTCCCCGGCCCCGCGCGGG + Intergenic
1084888120 11:72223828-72223850 CCGGCTCCCCGGGGCGGCGCGGG + Intronic
1085037206 11:73307809-73307831 GCGGCTCCCCGGGCTCTCCCTGG + Intergenic
1086887731 11:92224551-92224573 GCCGCTTCCAGGCCCGGCGCCGG + Intergenic
1089180593 11:116580558-116580580 GCGCCTCGCGGGCCCTGCGCGGG - Intergenic
1089533845 11:119149206-119149228 GCCCCGCCCCGGCCCCGCCCCGG + Exonic
1091600313 12:1914031-1914053 GCGGCTCCCCGGGCCCCCACAGG - Intronic
1091732364 12:2890700-2890722 GCGTCACCCCACCCCCGCGCAGG + Intronic
1094048594 12:26195428-26195450 GCGCCTGCCGGGCCCCGGGCAGG - Intronic
1094607318 12:31959698-31959720 GCGGCGGCCCGGCCCAGCTCCGG - Intronic
1095099294 12:38163716-38163738 CCGGCTGCCGGGCCACGCGCAGG + Intergenic
1096803608 12:54127202-54127224 GCGGATCCCCCGCCCCGTCCCGG - Intergenic
1097246419 12:57610129-57610151 GCAACTCCCCGGACGCGCGCAGG + Intergenic
1097281035 12:57845763-57845785 GCGGGTTCCCGGCTCAGCGCAGG - Intronic
1097848666 12:64390617-64390639 CCCTCTCCCCGCCCCCGCGCTGG + Exonic
1100347001 12:93742368-93742390 GCGGGTGCCCGGCCAAGCGCTGG - Intronic
1100347033 12:93742460-93742482 CCGGCTGCCCAGCCCAGCGCGGG + Intronic
1102256533 12:111418586-111418608 GCAGCTCCCCGGCCGAGCGGCGG - Exonic
1103534768 12:121626838-121626860 GGGGCTCCCCGTCCCCGCTGCGG - Exonic
1103649644 12:122422642-122422664 GCGCCCGCCCGGCCCCGCGGCGG - Intergenic
1103980563 12:124734421-124734443 GGGGCTCCCACGCCCCCCGCAGG - Intergenic
1104449043 12:128854245-128854267 GCCCCTCCCCGGGCCCCCGCCGG - Intronic
1104602343 12:130162304-130162326 CGGGCTCCCGGGCCCCGCGGGGG - Intergenic
1104912295 12:132245108-132245130 CAGGCTCCCCTGCCCCGCGGAGG + Intronic
1104916711 12:132269309-132269331 GCGGGTCCCATGCCCCCCGCGGG + Intronic
1105389235 13:19959250-19959272 GCCCCTCCCCCGCCCCCCGCCGG - Intronic
1105498707 13:20953012-20953034 GCAACTCCTCGGCCCCGCGTTGG - Intergenic
1105871949 13:24512909-24512931 GCGGGTCCCCGGCCTCTGGCGGG + Intergenic
1106157228 13:27170962-27170984 CCGAGTCCCCGACCCCGCGCTGG - Intronic
1106498706 13:30307177-30307199 GCCCCTCCCCGTCCCCGCACGGG + Intronic
1107548889 13:41457470-41457492 CCGGCTCCGCAGCCCCGCCCCGG + Intergenic
1108577658 13:51803726-51803748 GCGGCACCTCGGCGCCCCGCTGG - Intronic
1110318508 13:74135306-74135328 GCCGCCCCCGGGCCCCGCGGGGG - Intergenic
1110629984 13:77697533-77697555 GCGGCTCCCCGGCCCCAACCCGG + Intergenic
1112290737 13:98142888-98142910 GCAGATCCCCGGCGGCGCGCTGG + Intronic
1112652621 13:101416057-101416079 GCGGCTCCCGCGCCCCGGCCAGG + Intronic
1112693021 13:101917055-101917077 GCGGCTCCCCGGGCGCCGGCTGG + Intronic
1112771521 13:102799427-102799449 GCGCCTCGCCGGCCGCGCGCTGG + Exonic
1113082875 13:106535731-106535753 GCGGCTCCGCGGCCGCGCGCTGG + Intergenic
1113604006 13:111591897-111591919 GCGGCTCCCAGTCCCCACTCTGG - Intronic
1113604023 13:111592014-111592036 GCGGCTCCCAGTCCCCACTCTGG - Intronic
1113604056 13:111592247-111592269 GCGGCTCCCAGTCCCCACTCTGG - Intronic
1113861640 13:113490918-113490940 GCGGCTGCCAGGCCCCACGCCGG + Exonic
1117377476 14:55129390-55129412 TCGGCTCCCCGGGACCGGGCCGG + Intronic
1117920517 14:60722694-60722716 GCCGCCCCCCGGGCCTGCGCTGG - Intronic
1118220975 14:63853775-63853797 GCGCCCCCCCGCCCCCGCGGAGG - Intronic
1119435468 14:74595254-74595276 GCGGCTCCCCAGCCCTGACCTGG - Intronic
1121212008 14:92214178-92214200 GCGCCTCCCCGGCCCCTCCATGG - Intergenic
1121368149 14:93333068-93333090 CCGGCTCCGCAGCGCCGCGCAGG - Intronic
1122558227 14:102592780-102592802 GCGCCCGCCCGGCCCCGCGCCGG + Exonic
1122582207 14:102777786-102777808 GCGCCGCGCCGGGCCCGCGCCGG - Intronic
1122917482 14:104865660-104865682 GCGGGTCCCCGCCGCCGCGGAGG + Intronic
1122974987 14:105167421-105167443 GAGGCGCCCCGGTCCCGGGCAGG - Intronic
1122975305 14:105168466-105168488 CCGGCTCCCAGCCGCCGCGCCGG + Exonic
1124380366 15:29160169-29160191 TGGGCTCCGCGGCCCCGCACTGG - Intronic
1126099710 15:45111830-45111852 GCAGCACCACGTCCCCGCGCTGG + Exonic
1126103823 15:45135207-45135229 GCAGCACCACGTCCCCGCGCTGG - Exonic
1126837162 15:52679123-52679145 GCGGCTCCCCGGCGCCCCTGTGG + Intronic
1127103293 15:55588429-55588451 TGAGCTCCCCAGCCCCGCGCGGG + Intronic
1128078311 15:64841820-64841842 CCCCCTCCCCGGCCCCGCCCCGG + Intergenic
1128635276 15:69298868-69298890 GGGGCCGCCCCGCCCCGCGCGGG + Intergenic
1129538834 15:76335231-76335253 GTTCCTCACCGGCCCCGCGCTGG - Intergenic
1129541108 15:76347371-76347393 GCGGGTCCCCGCCCTCGAGCCGG + Intergenic
1132273208 15:100544502-100544524 GAGGGTCCTCGTCCCCGCGCAGG - Intronic
1132314562 15:100880250-100880272 CGGGCGGCCCGGCCCCGCGCGGG - Intronic
1132320144 15:100919489-100919511 GCTGCCTCCCGGCCCCGCCCGGG + Intronic
1132365143 15:101251615-101251637 GCCGCCCGCAGGCCCCGCGCCGG + Exonic
1132466164 16:78250-78272 GCGGCTGCTGGGCTCCGCGCCGG + Exonic
1132482302 16:172730-172752 CCCGCCGCCCGGCCCCGCGCAGG + Intergenic
1132483150 16:176534-176556 CCCGCCGCCCGGCCCCGCGCAGG + Intergenic
1132897799 16:2237180-2237202 GCGGCGCCCCGACCCTGAGCGGG + Intronic
1132934924 16:2475304-2475326 GGGGATCCCCGGCCACGCGCGGG + Intronic
1132943591 16:2520415-2520437 GCGGCTCCGGAGCCCCGCGGCGG - Exonic
1133188686 16:4117261-4117283 TCGCCTCCCAGGCCCAGCGCCGG + Intergenic
1134644925 16:15858260-15858282 GCGGGTCCCCGGCCTGGCGCGGG - Intergenic
1136141934 16:28293516-28293538 GCAGCTCCCCGGCCCCACGGAGG + Intronic
1136779003 16:32885607-32885629 GCCGCCCCCCGGCCCCCGGCCGG - Intergenic
1136891615 16:33975911-33975933 GCCGCCCCCCGGCCCCCGGCCGG + Intergenic
1137236308 16:46621225-46621247 GCGGCTCCTCGGCCCCGGCATGG + Intronic
1137530919 16:49278337-49278359 GCTGGTCCCCGGCCTGGCGCAGG + Exonic
1138389114 16:56657638-56657660 CCCGCCCCCCGGCCCCGCCCCGG - Intronic
1138619260 16:58198231-58198253 GCCCCGCCCCGGCCCCGCCCCGG + Intergenic
1141054795 16:80804655-80804677 GCTGCTGCCCGGCCGCGCCCCGG + Intergenic
1141479195 16:84294982-84295004 GCAGCTGCCCGGCCCCACGCCGG - Exonic
1141526925 16:84617788-84617810 CCCGCTCCCCGGGCTCGCGCGGG - Intronic
1141620848 16:85235879-85235901 CCCGCGCCCCGCCCCCGCGCTGG + Intergenic
1141709397 16:85689127-85689149 GCTGCGCGCCGGCCCCGCCCCGG + Intronic
1141948395 16:87325265-87325287 GCGGCACCCAGGCCCGGAGCAGG + Intronic
1142137013 16:88456074-88456096 CCGGCTCCCCGGCCCCAACCCGG - Intronic
1142285654 16:89170551-89170573 CGGGCTCCCCGGCCCGGCCCTGG + Intergenic
1142335799 16:89489527-89489549 GCGGCTCTCGGGCTCCGAGCCGG - Intronic
1142350381 16:89576769-89576791 GCAGCCGCCCGGGCCCGCGCTGG - Intronic
1203081414 16_KI270728v1_random:1147696-1147718 GCCGCCCCCCGGCCCCCGGCCGG - Intergenic
1142513156 17:410521-410543 GCGGCGCCGCGGGCCCGCGGGGG + Exonic
1143446866 17:7014944-7014966 GCGGCTCTTCCGCCCCGGGCGGG + Intronic
1143747089 17:9002963-9002985 CCGGCTCCCCTGCCCATCGCGGG - Intergenic
1143830235 17:9645463-9645485 GGGGCAGCCCCGCCCCGCGCGGG - Intronic
1144620934 17:16818121-16818143 GAGGCTGCCCAGCCCCGCTCAGG - Intergenic
1144756115 17:17681639-17681661 GCGGCGCCCCCTCCTCGCGCCGG - Exonic
1144775726 17:17783691-17783713 GGGGCTCCTCGCCCCCGCCCCGG + Intronic
1146283407 17:31559394-31559416 GCGGCCCCCAGGTCCCGGGCAGG + Intergenic
1147148313 17:38498713-38498735 GCAGCTGCCCCGCCCCGGGCAGG + Intronic
1147192818 17:38747576-38747598 CCCGCTCCCCGTCCCGGCGCCGG - Intronic
1147400529 17:40177932-40177954 GCAGCTCCCCAGACCCCCGCCGG - Intronic
1147572910 17:41582414-41582436 GAGGCTGCCCAGCCCCGCTCAGG - Exonic
1148081059 17:44967921-44967943 CCGGCGCCGGGGCCCCGCGCGGG + Exonic
1148652551 17:49260344-49260366 GCGGAGCCCCGGCCTCGCACGGG + Intergenic
1148899693 17:50866481-50866503 CCGGCACCCCGGTCCCCCGCCGG + Intronic
1148945599 17:51259897-51259919 GCGGCGCCCCCTCCCCGGGCTGG + Exonic
1152361196 17:79833906-79833928 TCAGCTCCCCGCCCCCCCGCGGG + Exonic
1152552192 17:81035391-81035413 GCGGCCCCGGGGCCGCGCGCCGG + Intronic
1152587099 17:81193990-81194012 GCAGCTCCTCGGCCTGGCGCAGG + Exonic
1152592987 17:81222768-81222790 GCTGCGCCCCCGGCCCGCGCAGG - Exonic
1152744275 17:82031866-82031888 GCGCCACCCCCGCCCCGCCCCGG - Intronic
1152805453 17:82353744-82353766 GTGGCTGCCCCGCCCCTCGCGGG + Intergenic
1156171745 18:34493995-34494017 GCGGCCCCGCGCCCCCGGGCCGG - Intronic
1156275612 18:35581132-35581154 TCGGCTCCCGGGCCGAGCGCGGG - Intronic
1157278987 18:46333815-46333837 GCGGGTCCCTGGCCGCCCGCGGG - Intronic
1157686416 18:49646130-49646152 GCTCCTCCCCAGCCCCACGCAGG - Intergenic
1159241803 18:65751164-65751186 GCGCCTCCCCAGCCCCGCGCAGG - Intronic
1160165553 18:76508015-76508037 GAGGCTCCCCCGCCACGAGCAGG + Intergenic
1160204749 18:76823024-76823046 GCGGCCCTCCGGCCCCGGGACGG - Intronic
1160453479 18:78980245-78980267 GCGGCGCTCGGGCCCCGCGCGGG - Intergenic
1160499735 18:79395802-79395824 CCTGCTGCCCGGGCCCGCGCGGG - Intergenic
1160586655 18:79916991-79917013 GCGTCTCCCCAGCACCGAGCAGG - Intronic
1160847554 19:1173264-1173286 GCTGCTCCCGGGCCCCACTCGGG + Intronic
1160914751 19:1491153-1491175 GCGATGCTCCGGCCCCGCGCCGG - Exonic
1160935476 19:1592637-1592659 CCGGCTCCTCGGCCCGCCGCCGG + Exonic
1160981907 19:1820091-1820113 GGGGCTCCCCGGCACCAGGCAGG - Intronic
1161120840 19:2525371-2525393 GACGCCGCCCGGCCCCGCGCTGG + Intronic
1161153482 19:2721158-2721180 GTGGCTCCGGGGCCCCTCGCCGG - Intronic
1161608751 19:5229456-5229478 GCCCGTCCCCGGCCCCGCCCCGG + Intronic
1161808767 19:6459685-6459707 GCGGCTCCCCCTCCCCCCCCGGG + Exonic
1161851765 19:6740871-6740893 GTGGCTTCCCGGCGCCGCCCCGG - Intronic
1162470760 19:10871114-10871136 GCGGCTTCCCTGCCCCGACCTGG - Intergenic
1162486094 19:10961273-10961295 GCCGTACCCCGGCCCCGCACAGG - Intronic
1162914026 19:13865047-13865069 GCAGCTCCCGGGGCCCGCGCGGG - Intronic
1163020044 19:14476989-14477011 GCGGCTCCCCGACTCCACCCGGG + Intergenic
1163157875 19:15449248-15449270 CTGGCGCCCCGGCCCCGCCCCGG - Intronic
1164624100 19:29715207-29715229 CCAGCTCCCCAGCCCCGCGGAGG + Intronic
1165463609 19:35959181-35959203 GCAGCTCCTCTGCCCCGGGCGGG - Intergenic
1165861606 19:38912047-38912069 CCCGCTCCCCGGCCCCTGGCAGG + Intronic
1166547037 19:43639882-43639904 TCGGCGCCCCGCCCCCGGGCGGG - Intergenic
1166547055 19:43639907-43639929 TCCCCTCCCCGGCCCCGCCCCGG - Intergenic
1167414356 19:49362376-49362398 GCGGCTCCCCAGCCCCAGGCCGG - Intronic
1168335124 19:55593043-55593065 GCTGCTCCTGGGCCCCGCGGGGG - Exonic
1168345387 19:55648221-55648243 GCGGCGCCCATGCCCGGCGCCGG - Exonic
1168692882 19:58387346-58387368 TAGGATCCCCGGCCCCGCGGCGG - Exonic
926155101 2:10448985-10449007 CCGCCTCCACGCCCCCGCGCTGG + Intergenic
926202535 2:10812391-10812413 GCGGCTCTCCCGCCCGGCCCTGG + Intronic
926367184 2:12144182-12144204 GCCGCTCCTCAGCCCCGAGCAGG + Intergenic
927140808 2:20129623-20129645 GCCTCTCCCTGGCCCCGCGAGGG + Intergenic
927181114 2:20447333-20447355 GCTGCACCCGGGCCCCGCGGTGG - Exonic
927713972 2:25341274-25341296 GCGGGGGCCGGGCCCCGCGCAGG - Intronic
927904881 2:26848866-26848888 GCGGCTGCCCAGCCCGGAGCGGG + Intronic
928511776 2:32010097-32010119 TCGGCGGCCCGGCCCCGCGGCGG - Intronic
929936332 2:46297060-46297082 GCCGCCCCTCGGCCCTGCGCAGG + Intronic
931868330 2:66434431-66434453 GCGGCTCCCAGCCCCAGCCCAGG - Intronic
932435862 2:71702284-71702306 GCTGCACCCCAGCCCCGGGCAGG - Intergenic
936713603 2:115161400-115161422 GCGGTTACCCCGCCCCCCGCAGG - Intronic
937221308 2:120344568-120344590 CCGCCTCCCCGCCGCCGCGCAGG - Intergenic
937995997 2:127695565-127695587 CTGGCACCTCGGCCCCGCGCGGG - Intergenic
939629448 2:144516070-144516092 GCGTCTACGCGGCCCCGCGCCGG + Intronic
940775110 2:157876443-157876465 CCGGCTCCCTGGATCCGCGCCGG - Intergenic
940971989 2:159904832-159904854 GCGTCTCCTCGGCCCCGGGGCGG + Intergenic
941021041 2:160407970-160407992 GCGCCTCCCCGCCCGCCCGCTGG + Intronic
941934686 2:170973673-170973695 GCGACGCCCCGGCCCCGCCCAGG - Intergenic
943715729 2:191150687-191150709 GCAGCTCCCCTGGCCCCCGCAGG + Intronic
944159056 2:196639781-196639803 GAGGCTGCCGGGCCCCGGGCTGG + Intronic
945699535 2:213152249-213152271 GCGGCTCCCGGACTCCGCGCAGG - Intronic
946286990 2:218711187-218711209 GCGGCTCCCTGGCCTCCCGGGGG - Intronic
946308789 2:218871578-218871600 GCGGCTGCCAGGCGCCCCGCGGG + Exonic
946367038 2:219254569-219254591 GCGGCTCGCCGGCCGCCCGCGGG + Intronic
946411200 2:219515966-219515988 GCGGCTCCCATGCCCAGCTCTGG + Intronic
947549813 2:231037967-231037989 GCGCCGCCCCGGCCCGCCGCCGG - Exonic
948393339 2:237627574-237627596 GCGCCGCCCCGGCCCGGCCCCGG - Intronic
948674468 2:239588883-239588905 GGGGCTCCAGGGCCCTGCGCAGG - Intergenic
948806589 2:240455835-240455857 GCGGAGCTCCGGCCCGGCGCAGG - Intronic
948983633 2:241507702-241507724 GCAGCGCCCCGTCCCTGCGCCGG + Intronic
949037199 2:241821300-241821322 GCGGCTCCCCGGCACCCAACCGG + Intergenic
1171982533 20:31637997-31638019 GCCGCGCCCCTGACCCGCGCGGG - Intronic
1172100633 20:32482772-32482794 GGGGTTCCCCGGCGCGGCGCGGG - Intronic
1172245738 20:33443828-33443850 TCGGCTCCCGGGCCCCGCCCCGG - Exonic
1172277192 20:33686189-33686211 GCAGCGCGCCGGCCCCGAGCAGG + Exonic
1173734295 20:45348457-45348479 GCGGCCTACCGGCCCCGCCCCGG + Intergenic
1174648459 20:52105060-52105082 GAGGTTCTCCGGACCCGCGCGGG - Intronic
1174898682 20:54476093-54476115 GAGAGTCCCCGGCCGCGCGCCGG + Intronic
1175826056 20:61937127-61937149 GCCGCTGCCCAGCACCGCGCTGG + Exonic
1175859577 20:62143171-62143193 CCGCGTCCCCGGCCCCGCGCAGG + Intronic
1175990355 20:62785525-62785547 GCGGCTGCCTGCCCCTGCGCTGG + Intergenic
1176159692 20:63641918-63641940 GCTCCGCCCCGGCCCCGCCCCGG + Intronic
1176159746 20:63642043-63642065 GCTTCGCCCCGGCCCCGCCCCGG + Intronic
1176722826 21:10405605-10405627 GCCGCTCCCAGGCGGCGCGCCGG + Intergenic
1179511845 21:41878892-41878914 GCAGCCCCGCGGCCCCGCGCTGG + Intronic
1179810219 21:43865280-43865302 TCGCCTCCGCGGCCCCGCTCTGG - Intronic
1179875910 21:44267327-44267349 GGGGCTCCCCAGCCCCCAGCGGG - Intergenic
1179909668 21:44441187-44441209 GTGGCTCCCCGGCCTCTCCCTGG - Intronic
1180170959 21:46057908-46057930 GCGGCTCCTGTCCCCCGCGCGGG + Intergenic
1180303990 22:11058347-11058369 GCCGCTCCCAGGCGGCGCGCCGG + Intergenic
1180559146 22:16601745-16601767 GCGGCCCGCCCTCCCCGCGCCGG + Intergenic
1180614896 22:17120672-17120694 GCGGCTCCCGGGGCCCCCGACGG + Exonic
1180620542 22:17159060-17159082 GCGGCTCCCCGCCCCGCCTCCGG + Intronic
1180699724 22:17774572-17774594 CCCGCTCCACAGCCCCGCGCCGG - Intronic
1180764830 22:18340270-18340292 GCGGCTCAGCGGGCCCGTGCTGG + Intergenic
1180814200 22:18779414-18779436 GCGGCTCAGCGGGCCCGTGCTGG - Intergenic
1180910628 22:19447564-19447586 GCGGCCGCCGGGCCCCGCTCAGG - Intronic
1181085488 22:20437702-20437724 CCGGCTCCCCGGCGCCGCGCCGG + Exonic
1181200385 22:21213749-21213771 GCGGCTCAGCGGGCCCGTGCTGG - Exonic
1181934547 22:26429389-26429411 GCGGCTCCGCGGCGCCGGGCAGG + Exonic
1182294939 22:29307088-29307110 GCGGCGGCCCGGCCCGGCTCCGG + Exonic
1182558166 22:31140277-31140299 GGGGCTCCCCTGCCCTCCGCTGG - Exonic
1183313571 22:37124846-37124868 GCGGCTGCCCGGTCCCCAGCTGG + Intergenic
1183700156 22:39446483-39446505 GCCGCTCCCTGGCCCCGCCTCGG + Intergenic
1185211739 22:49574361-49574383 GCTGCTGCCTGGCCCCCCGCAGG - Intronic
1185222407 22:49635797-49635819 GCAGCACCCCAGCCCCGCGGTGG - Intronic
1185413495 22:50697749-50697771 GCGCCGCCCCCTCCCCGCGCCGG - Intergenic
1203226452 22_KI270731v1_random:81175-81197 GCGGCTCAGCGGGCCCGTGCTGG + Intergenic
1203264298 22_KI270734v1_random:5101-5123 GCGGCTCAGCGGGCCCGTGCTGG - Intergenic
950443533 3:13023321-13023343 GCTGCTCCCAGGCCCAGCCCAGG + Intronic
953246436 3:41198897-41198919 GCGGGTTCCCGGCCGGGCGCGGG - Intronic
954004014 3:47578311-47578333 GCCCCGCCCCGGCCCCGCCCCGG + Intronic
954131039 3:48561059-48561081 GCTGCTCCCCGGCCCCAGGTCGG + Intronic
954367586 3:50154807-50154829 GCGGCGCCCCCGCCCCGCCCTGG - Intergenic
956487612 3:69739443-69739465 GCGGCCGCCCGCCCCAGCGCGGG - Exonic
956675034 3:71725319-71725341 GCGGCTCCCGGGCCCCGGCGGGG + Exonic
961322294 3:126084179-126084201 GGGCCTCCCTGGCCCCGCCCCGG + Exonic
961389204 3:126542423-126542445 GCGGCTCCCCGGGGCCGCGGCGG - Exonic
961665109 3:128489585-128489607 GCGGCTTCCCGGGCTGGCGCCGG - Intronic
962411240 3:135143393-135143415 GCAGCTCCCCTGCCCAGCGTTGG + Intronic
966794201 3:183698163-183698185 GCGGCTCCCCGGCCCGCACCTGG - Intronic
966878891 3:184338651-184338673 GCGGCCTCCCGGCCCGCCGCCGG - Intronic
967207811 3:187139538-187139560 GCCCCGCCCCGGCCCCGCCCAGG + Intronic
967824845 3:193869791-193869813 GCGGCTCCGGGGCTCCTCGCTGG - Intergenic
967963251 3:194941798-194941820 GCGGCGCCCTGGCCCCACTCAGG - Intergenic
968199559 3:196740264-196740286 GCGGCTCCCCGGCCCCGCGCGGG - Intronic
968462203 4:731645-731667 GGGGCTCCCCCGCCCCTCGTGGG + Intronic
968514981 4:1012014-1012036 GCCCCTCCCCGCCCCCGCCCCGG - Intronic
968698060 4:2042269-2042291 GGGGCTCACCGGCCCGGGGCGGG + Intronic
968965094 4:3765763-3765785 ACTCCTCCCCGGCGCCGCGCGGG + Intergenic
969240382 4:5893122-5893144 GCCCCGCCCCGGCCCCGCCCCGG - Intergenic
969357873 4:6641271-6641293 GCCGCTCCTCGGCCTGGCGCGGG - Intronic
971457763 4:26860620-26860642 GCGGCATCCCAGCCCCGCCCCGG - Intronic
973636069 4:52862747-52862769 ACCGCTCTCCGTCCCCGCGCAGG + Intronic
974055158 4:56976937-56976959 GCGGCGGCCCGGCCCCTCCCTGG - Exonic
975689523 4:76950019-76950041 GCGGGTGCTCGGCCCCGCGGCGG + Intronic
976431351 4:84966323-84966345 GGGGCTCCCGGGCCCCGCCGCGG - Exonic
976629321 4:87220546-87220568 GGGGCTCCGCGGGGCCGCGCAGG - Exonic
976690594 4:87863844-87863866 CCGGCCCCCCGGCGCTGCGCTGG - Intergenic
977693922 4:99946757-99946779 GCGGCCTCCCCGCCCCCCGCGGG + Intergenic
979547273 4:121951969-121951991 GAGGCTCTCCAGCCCCGCGGCGG + Intergenic
981074700 4:140579364-140579386 GGGGCTCCCCGGACCTGCGCTGG + Intergenic
982564540 4:156971486-156971508 GGAGCCCCCCGGCCCCGCTCCGG - Intergenic
984701164 4:182819610-182819632 GAGGCTCCCCGGCCTCCCGCAGG + Intergenic
984917017 4:184734048-184734070 GCGGCACCATGGCCCCGCGGGGG - Exonic
984999808 4:185471723-185471745 CCCGCTCCGCCGCCCCGCGCAGG + Exonic
985575981 5:673699-673721 GCTGGTCCCCGGCCCCACACTGG + Intronic
985580796 5:694198-694220 GGGGCTGCCCGGCCCTCCGCAGG + Intergenic
985630113 5:1009598-1009620 ACCGCTCCCCGCCCCCGGGCGGG - Intronic
985718394 5:1475740-1475762 GGGGCTGCACGGCCCCGCCCAGG + Intronic
985718415 5:1475808-1475830 GGGGCTGCACGGCCCCGCCCAGG + Intronic
989584807 5:43066496-43066518 CGGGCTCCCCCGCCCAGCGCCGG + Intronic
990557778 5:56952294-56952316 GCCCCTCGCCGCCCCCGCGCCGG + Intronic
992106243 5:73451305-73451327 CCGGCTCCCCGCCCCCAAGCTGG + Intergenic
992690452 5:79236326-79236348 GCAGCTCCACGGCCTCGCGCGGG + Exonic
993386348 5:87267762-87267784 CCGGCCCCCCGCCCCCGCTCCGG + Intergenic
995402426 5:111757714-111757736 TCTGCGCCCCGGCCCCGCCCCGG + Intronic
997304025 5:132825546-132825568 CCGGCTCCCCCTCCCCGCCCGGG + Exonic
997950973 5:138242224-138242246 GCTGCGCCCCAGCCCCGCACCGG - Intergenic
998424201 5:142013029-142013051 CCGGCGGCCCGGCCCCGCGCGGG + Intronic
1001070265 5:168579458-168579480 GCGGCCCCCCACCCCCGCGAGGG + Exonic
1002021304 5:176365878-176365900 GCAGCGCACAGGCCCCGCGCGGG + Intronic
1002190178 5:177473733-177473755 GCGCCGCCCCGGCCCGGCCCAGG + Intronic
1002279459 5:178122102-178122124 GCGCCTCCCCAGCCCCGGGCTGG - Exonic
1002447924 5:179301530-179301552 GCTCCTCCCCAGCCCCGCACTGG + Intronic
1002722766 5:181273522-181273544 GCCGCTCCCAGGCGGCGCGCCGG + Intergenic
1003868680 6:10384866-10384888 GCGGCTCCCGCGCCCCGGCCCGG - Intergenic
1004194000 6:13487772-13487794 GCTCCTCCCCGGCCCCGCCCAGG + Intergenic
1006453712 6:34120291-34120313 GGGGCTCCCTGGCCCAGGGCTGG + Intronic
1006558454 6:34889167-34889189 GGGGCTCCGCGGACCAGCGCAGG - Intergenic
1006574263 6:35032495-35032517 GCGGCTCCCCAGCCCCAAACGGG + Intronic
1006642915 6:35497671-35497693 CCGGCTCCCCGGGCCCCCACGGG + Intergenic
1007406376 6:41638335-41638357 GCGGGTCCCCTCCCCCGCGCCGG - Intronic
1007557792 6:42781921-42781943 GCGGCGCCCCGGCCCGGCGCGGG + Intronic
1007644349 6:43369114-43369136 GCGTCTCCCCGTCCCCGCCTCGG - Exonic
1012548355 6:100446690-100446712 CCGGCGCCCAGGCCCCGCGCGGG - Intronic
1013230409 6:108157385-108157407 GCGGCTTCCAGGCCTCGGGCTGG + Intronic
1013272949 6:108559950-108559972 GCCGTGCCCCGGGCCCGCGCGGG + Intronic
1013582731 6:111552090-111552112 GAGCCTCCCCGGCACCGAGCAGG - Intergenic
1015935637 6:138404217-138404239 GCGGCTCCCTGTCGCCGCGGAGG + Exonic
1017738121 6:157381640-157381662 CCGGCTCCCCGGCCGCGCCTCGG - Exonic
1018960198 6:168441994-168442016 GCGGATCCCGGGCCTCTCGCCGG + Intronic
1019343820 7:520263-520285 GCCGGTCCCCGCCCCCGCCCCGG + Intronic
1019395765 7:816850-816872 GCAGCTACCCCGGCCCGCGCAGG + Intronic
1019681994 7:2355431-2355453 GCCGCTCGCCAGCCCCGCCCCGG - Intronic
1020114786 7:5470375-5470397 GCAGCTGCCCGGGCCTGCGCTGG - Intronic
1020278078 7:6636872-6636894 CCAGATCCCCGGGCCCGCGCGGG - Intergenic
1021891969 7:25194895-25194917 GCTGCTCCCCTGCCCCAAGCTGG - Intergenic
1022207580 7:28179721-28179743 CCGCGTCCCCGGCCCCGCCCGGG + Intronic
1022427692 7:30284645-30284667 GAGGTTCCCCGGCCCCGCGCCGG - Exonic
1024308867 7:47950823-47950845 GAGGCTGCCCAGCCCAGCGCTGG - Intronic
1024971816 7:55078321-55078343 GCGGCTTCCTGGCACCGCTCTGG - Intronic
1026471030 7:70694324-70694346 GCGCCTCCTGGGCCGCGCGCCGG + Intronic
1026850352 7:73719708-73719730 GCGCCAGCCCGGCCCCGCCCCGG + Intergenic
1027001770 7:74658612-74658634 GCGCGGCCCCGCCCCCGCGCCGG - Intronic
1029207498 7:98878447-98878469 GCCCCTCCCCGTGCCCGCGCAGG + Intronic
1031846040 7:126806820-126806842 GCGCCTACCCGGAACCGCGCCGG + Intronic
1033159167 7:138981474-138981496 GCCGCTGCCCGGCAACGCGCGGG + Intergenic
1033654386 7:143362865-143362887 GCGCCTCCCCGCCCCTGCTCCGG + Intergenic
1035018648 7:155787680-155787702 GAGGCTCTCCTGCCCCGCGGAGG + Intergenic
1036383321 8:8254462-8254484 GCTGCTTCCAGGCCCCGCCCAGG - Intergenic
1036707984 8:11059433-11059455 TCAGCTCCGCGTCCCCGCGCCGG + Intronic
1036739515 8:11347897-11347919 GCGGCTCCGGAGCCCGGCGCGGG + Intergenic
1038444359 8:27593072-27593094 CCGCCCCCCCGGCCCCGCGCAGG - Intergenic
1040850676 8:51898607-51898629 GCGGCGCCCCGGCCTCCCTCGGG + Intronic
1044692860 8:94896146-94896168 GCCGTTCCCGGGCCCCGCTCCGG - Intronic
1045564488 8:103299186-103299208 GGGGCCCCGCGGCGCCGCGCAGG + Intronic
1048969885 8:139639567-139639589 ATGGCTCCCCAGCCCAGCGCTGG + Intronic
1049419573 8:142510829-142510851 GCGGCTCCGCGCCCCGGCCCCGG - Intronic
1049585414 8:143430525-143430547 TCGGCGCCGCCGCCCCGCGCCGG - Intergenic
1049795770 8:144496687-144496709 GCTGCTCCCAGGCCCCACCCAGG + Exonic
1051291781 9:15552811-15552833 GGAGCTCCGCGTCCCCGCGCGGG - Intergenic
1054905919 9:70413619-70413641 CCGCCGCCCCTGCCCCGCGCCGG + Exonic
1057259760 9:93576963-93576985 GCGGCGGCCCGTCCCCGAGCCGG - Intronic
1057259897 9:93577340-93577362 GCCTCTCCCGGGACCCGCGCCGG - Intronic
1057432351 9:95005336-95005358 GCCGCTCCCCGCGCCCGAGCCGG - Intronic
1057716760 9:97501843-97501865 GGGGCTCCCTGCCCCCGCTCCGG + Intronic
1058885882 9:109320823-109320845 GCTGCTCCCGCGCCGCGCGCCGG + Exonic
1059208258 9:112486788-112486810 CCCGCTCGCCGGCCCCGCCCCGG + Intronic
1060599595 9:124869195-124869217 GCCGCTTCCCGCCCCCGAGCAGG + Exonic
1062229612 9:135474422-135474444 GCAGCTCCCCCGCCCTGGGCAGG + Intergenic
1062367186 9:136216497-136216519 GCGGAGCCCGGGCCCCGAGCAGG + Intronic
1062389989 9:136330058-136330080 GGGGCTCCCTGGCCCAGAGCAGG + Intronic
1062571739 9:137188935-137188957 CTGGCTCGCAGGCCCCGCGCCGG + Intronic
1062574532 9:137200158-137200180 GCCGCGCCCGGGCCCCGCGGTGG - Exonic
1185890234 X:3816083-3816105 GCGGCTCTCGGGCTCCGAGCCGG + Intergenic
1190108310 X:47574143-47574165 GCGGGTCCCGTGCCCCGCACTGG - Exonic
1195269393 X:103215344-103215366 GCAGCCCCCGGGCCCCGCGGCGG + Intronic
1196007329 X:110850583-110850605 GCGGCTGCCCTGCCCCGGGTAGG - Intergenic
1200100802 X:153688447-153688469 GCCGCCCCCCGGCCCCCGGCCGG + Exonic
1200292677 X:154887064-154887086 GCGTCGCCCCGGGCCCGGGCTGG - Exonic
1200339521 X:155382804-155382826 GCGTCGCCCCGGGCCCGGGCTGG - Exonic
1200346949 X:155457889-155457911 GCGTCGCCCCGGGCCCGGGCTGG + Exonic