ID: 968199559

View in Genome Browser
Species Human (GRCh38)
Location 3:196740264-196740286
Sequence GCGGCTCCCCGGCCCCGCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 412
Summary {0: 1, 1: 0, 2: 5, 3: 39, 4: 367}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968199559_968199569 9 Left 968199559 3:196740264-196740286 CCCGCGCGGGGCCGGGGAGCCGC 0: 1
1: 0
2: 5
3: 39
4: 367
Right 968199569 3:196740296-196740318 GCTGGGAGCCGCAGCTCCTGGGG 0: 1
1: 0
2: 4
3: 32
4: 357
968199559_968199563 -8 Left 968199559 3:196740264-196740286 CCCGCGCGGGGCCGGGGAGCCGC 0: 1
1: 0
2: 5
3: 39
4: 367
Right 968199563 3:196740279-196740301 GGAGCCGCCACCTGCGTGCTGGG 0: 1
1: 0
2: 1
3: 11
4: 106
968199559_968199571 15 Left 968199559 3:196740264-196740286 CCCGCGCGGGGCCGGGGAGCCGC 0: 1
1: 0
2: 5
3: 39
4: 367
Right 968199571 3:196740302-196740324 AGCCGCAGCTCCTGGGGCGGTGG 0: 1
1: 0
2: 3
3: 38
4: 431
968199559_968199568 8 Left 968199559 3:196740264-196740286 CCCGCGCGGGGCCGGGGAGCCGC 0: 1
1: 0
2: 5
3: 39
4: 367
Right 968199568 3:196740295-196740317 TGCTGGGAGCCGCAGCTCCTGGG 0: 1
1: 0
2: 1
3: 40
4: 497
968199559_968199570 12 Left 968199559 3:196740264-196740286 CCCGCGCGGGGCCGGGGAGCCGC 0: 1
1: 0
2: 5
3: 39
4: 367
Right 968199570 3:196740299-196740321 GGGAGCCGCAGCTCCTGGGGCGG 0: 1
1: 0
2: 6
3: 47
4: 782
968199559_968199562 -9 Left 968199559 3:196740264-196740286 CCCGCGCGGGGCCGGGGAGCCGC 0: 1
1: 0
2: 5
3: 39
4: 367
Right 968199562 3:196740278-196740300 GGGAGCCGCCACCTGCGTGCTGG 0: 1
1: 0
2: 2
3: 11
4: 168
968199559_968199567 7 Left 968199559 3:196740264-196740286 CCCGCGCGGGGCCGGGGAGCCGC 0: 1
1: 0
2: 5
3: 39
4: 367
Right 968199567 3:196740294-196740316 GTGCTGGGAGCCGCAGCTCCTGG 0: 1
1: 1
2: 7
3: 82
4: 494

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968199559 Original CRISPR GCGGCTCCCCGGCCCCGCGC GGG (reversed) Intronic