ID: 968206508

View in Genome Browser
Species Human (GRCh38)
Location 3:196806964-196806986
Sequence TGAGATAAACAGAGAAAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 528
Summary {0: 1, 1: 0, 2: 2, 3: 33, 4: 492}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968206508 Original CRISPR TGAGATAAACAGAGAAAGCT TGG (reversed) Intronic
900703567 1:4062447-4062469 AGAGAGAAACAGAGAGAGCGAGG - Intergenic
900925264 1:5701809-5701831 AGAGATAAAGAGAGAAAGAGAGG + Intergenic
902363481 1:15955413-15955435 TTAGATAAACATATAAATCTTGG + Intronic
902404705 1:16176268-16176290 AGAGAAAAACAGAGAAAGGGAGG - Intergenic
903422333 1:23226906-23226928 TCAGGGAAACAGAGGAAGCTAGG + Intergenic
903829434 1:26165686-26165708 TGAGAGAAACAGAAACAGCCTGG + Intergenic
903853538 1:26322086-26322108 GGAGATAGTCAGAGAGAGCTGGG + Intronic
904346035 1:29870616-29870638 TGATATCAACAGGGAAAGCAGGG + Intergenic
904423079 1:30406478-30406500 TGATATAAACAGGGAAGCCTGGG - Intergenic
904426073 1:30424033-30424055 TGAAATAAACACAAACAGCTCGG + Intergenic
904959290 1:34318747-34318769 TGAAAGAGACAGAGAAAACTGGG + Intergenic
905692010 1:39950357-39950379 TGAAATTAAAAGAGAATGCTGGG - Intergenic
905938106 1:41840760-41840782 CGACATAACCAGAGGAAGCTTGG + Intronic
906343006 1:44997109-44997131 TCATATAAACAGAGAGGGCTAGG + Intergenic
906828222 1:49004681-49004703 TGAGAGAAACAGAGGAAGGCAGG + Intronic
906829043 1:49012487-49012509 TAAGATAAGAAGAGAGAGCTAGG + Intronic
908336718 1:63133072-63133094 TGAGGTTGCCAGAGAAAGCTGGG + Intergenic
909156427 1:72083517-72083539 AAAGACAAACAGAGAGAGCTGGG - Intronic
909213808 1:72859575-72859597 TAAAATGGACAGAGAAAGCTTGG + Intergenic
909367460 1:74844526-74844548 TGAGAAAAAGAGAGAAAGAATGG + Intergenic
909385741 1:75054095-75054117 GGAGATAAACTGACAAAGTTGGG + Intergenic
909637438 1:77832710-77832732 GGAGATGAACCTAGAAAGCTGGG + Intronic
909692786 1:78428772-78428794 TGACATAAAGACAGAAAACTAGG - Intronic
911179571 1:94848786-94848808 TGTGATGATCAGAGAAATCTGGG + Intronic
911877096 1:103180487-103180509 TGAGATCTACAGAGAAATGTAGG - Intergenic
911956115 1:104237202-104237224 TGAGAAAAACAAAGAAAGTGAGG - Intergenic
914504549 1:148277566-148277588 TGGGATAAACAGAGAAAAGAAGG - Intergenic
914509747 1:148320711-148320733 TGGGATAAACAGAGAAAAGAAGG + Intergenic
914784541 1:150816692-150816714 TGAAGTAACCAGAGAAAGCAAGG + Intronic
915309221 1:154999094-154999116 TGAGAGTAACTGAGAAAGTTGGG - Intergenic
915790943 1:158670495-158670517 TAAGATTAACAGAGAAGACTAGG + Intronic
916161392 1:161919237-161919259 TGAAATAAAAATAGAATGCTAGG + Intronic
916173346 1:162018580-162018602 TGATAAAAACTGAGAAGGCTGGG - Intronic
916401011 1:164448551-164448573 AGAGATAAACAGAGACTACTAGG - Intergenic
916440296 1:164818397-164818419 TAAGCTAAACAGAGAAATGTGGG + Intronic
916733819 1:167589535-167589557 GGAGATAAACAAAGAAATATTGG + Intergenic
916932798 1:169596686-169596708 TGAGAGAAACAGACAATACTGGG - Intronic
918323353 1:183385574-183385596 TGATATAAACAGACAGAGCCTGG + Intronic
918906971 1:190509042-190509064 TGAGATAAACCGTCATAGCTGGG + Intergenic
919015811 1:192033952-192033974 TAAGATAAACTGAAAAGGCTGGG - Intergenic
919464032 1:197910859-197910881 TGGGATGAAAAGAGAAAGCCAGG + Intergenic
920403455 1:205692004-205692026 TGAGAGGATCAGAGAATGCTTGG + Intergenic
920996243 1:210995330-210995352 TGAGAGAATCACAGAAATCTTGG + Intronic
921517309 1:216111283-216111305 TGATATAAACAGGGAATACTAGG - Intronic
922972818 1:229757556-229757578 TCAGATAAACAGGAAAAGGTTGG + Intergenic
923205404 1:231754012-231754034 TGATATGAACAGTGAAAGCCAGG - Intronic
923872127 1:238006821-238006843 AAATATAAACAGAGAAAGCTTGG - Intergenic
924173635 1:241366899-241366921 TAAGACAAACAGAGAGGGCTGGG + Intergenic
1063757625 10:9032707-9032729 TGAGATAAACGTAGAAAACTGGG - Intergenic
1064227204 10:13497629-13497651 TGAGAGAAACAGAATAAGATAGG - Intronic
1064695076 10:17956806-17956828 TTAGATAATAAGACAAAGCTGGG - Intronic
1065765672 10:29027197-29027219 TTTGAGAGACAGAGAAAGCTGGG - Intergenic
1067247005 10:44555670-44555692 TGAAATAAAAAGAGAAATCTAGG - Intergenic
1068302072 10:55156813-55156835 TGGGCTAAACAGAGAGAGGTTGG + Intronic
1069375451 10:67788445-67788467 GGAGATGGTCAGAGAAAGCTAGG + Intergenic
1070962236 10:80507204-80507226 TGAAAGAGACAGAGAAAGCAGGG - Intronic
1072074613 10:91957383-91957405 TGAGACAAACAGAGAAGAATAGG - Intronic
1073056443 10:100706154-100706176 TGAGATAATCAGAGAAAGTATGG - Intergenic
1075350850 10:121723803-121723825 GGAGATAAACAGAAAAATCAGGG + Intergenic
1076584053 10:131533332-131533354 TGAGAGACACAGAGGAGGCTCGG + Intergenic
1077976765 11:7254702-7254724 GGACAATAACAGAGAAAGCTGGG - Intronic
1078455327 11:11470414-11470436 TGAGATAAATGGAGAAGGATAGG - Intronic
1079630738 11:22671328-22671350 TTAGGTAGACCGAGAAAGCTTGG + Intronic
1080169066 11:29276914-29276936 TGAGGGAAACAGAGAAAGCTTGG + Intergenic
1080235316 11:30061644-30061666 TGAGACAAACAGAAAAAGTATGG + Intergenic
1080260460 11:30344021-30344043 TAAGCTAAACAGAGAATACTTGG + Intergenic
1080825045 11:35841226-35841248 TAAGAAATACAGAGAAAGCCAGG + Intergenic
1081083633 11:38773353-38773375 TCAGATATACAAAGAAGGCTTGG + Intergenic
1081525506 11:43925004-43925026 AGAGAAAGAGAGAGAAAGCTGGG - Intergenic
1082106083 11:48223200-48223222 TGAGAAAAAGAGAGAAATCAAGG - Intergenic
1082919633 11:58479183-58479205 TGAGACAAAAAGAGAAAGGGTGG + Intergenic
1083475371 11:62911883-62911905 GAAGATAAACAGAGAGAGATGGG + Intronic
1083798424 11:65032154-65032176 TGAGATGAACTGAGAAAGAAAGG - Exonic
1084952543 11:72674582-72674604 AGAGATAAACAGAGACAGGAAGG + Intronic
1085243170 11:75075266-75075288 AGAGATAGGCAGAGAAATCTGGG - Intergenic
1086299528 11:85411284-85411306 TGAGAAAGAAAAAGAAAGCTTGG + Intronic
1086471222 11:87113578-87113600 AGAGACAAAAAGAGAAAGCATGG + Intronic
1086751023 11:90493641-90493663 TGAGATATCCAGAGACAGCTAGG - Intergenic
1087285124 11:96256747-96256769 TGAGCTAGACAGACAAAGATAGG + Intronic
1087394823 11:97584136-97584158 TGAGACAGACAGGGAAAACTGGG - Intergenic
1087450646 11:98317671-98317693 TGAGGTAAACACAGAAAGATAGG - Intergenic
1087800612 11:102499321-102499343 AGAGACAAGCAGAGCAAGCTTGG + Intergenic
1088130782 11:106487386-106487408 TGAGATAAAAATAGAGAGATTGG + Intergenic
1088455113 11:110025337-110025359 TGAGATAGACAGATATAGATAGG + Intergenic
1088516502 11:110641046-110641068 TTAGATAAACAGAGTGAGCAAGG + Intronic
1089386637 11:118072658-118072680 AGAGATAAAAAGAGAACACTTGG - Intergenic
1089746083 11:120618088-120618110 TGATATGAACAGAGATAGCCAGG + Intronic
1090155127 11:124429100-124429122 GGAGATAAAAAGATAAAGCCTGG + Intergenic
1090403632 11:126464632-126464654 AGAGAGAAACAGAGAAGGCCAGG + Intronic
1090942618 11:131401063-131401085 TGAGACAAACAGAGAGAGACAGG + Intronic
1091469525 12:714782-714804 TGAGAGCAAGAGAGAAAGCAGGG + Intergenic
1092726533 12:11491769-11491791 TCAGATGAACTAAGAAAGCTGGG - Intronic
1093316142 12:17652676-17652698 TGAGATAAACAGTGGAAAATTGG - Intergenic
1093469492 12:19485410-19485432 TGAGAAAAACAGAGTAGGCCGGG + Intronic
1094662380 12:32482277-32482299 TGGGAAAAACAGAGACAGATGGG + Intronic
1095928910 12:47606540-47606562 TGACATAAACAGTGAAATCCAGG - Intergenic
1097445237 12:59662619-59662641 TGAGATAAACACAGACAGTGAGG - Intronic
1097580268 12:61447298-61447320 TGGGAAAAGCAGAGAAATCTTGG - Intergenic
1097916599 12:65026861-65026883 TGAGGTTAAGAGAGACAGCTAGG - Intergenic
1097984201 12:65766348-65766370 TGATATCAACAGAGCAAGCCTGG - Intergenic
1098520184 12:71426563-71426585 TGAGCAAAACAAATAAAGCTTGG + Intronic
1098645823 12:72899838-72899860 TGGGAGAAACAGAGAAAGACAGG - Intergenic
1098779953 12:74674386-74674408 TGAGATACAGAGGGAAAGTTTGG + Intergenic
1098827308 12:75312712-75312734 TGCAGTAAACAGAGAAAGTTTGG + Intronic
1098877680 12:75883729-75883751 TGAGAGAAAGAGAGAAGGCAAGG - Intergenic
1099198249 12:79645359-79645381 TGTGATGAACAGAGGAAGTTTGG + Intronic
1099487038 12:83241704-83241726 TGACATAGACACAGAAAGGTGGG - Intergenic
1099813695 12:87618938-87618960 TGACAGAGAAAGAGAAAGCTTGG - Intergenic
1100018062 12:90035966-90035988 TGAGAGAAGCGGAGAAAGTTTGG + Intergenic
1100129853 12:91478301-91478323 TGAAATAAGCACAGAAAGGTAGG + Intergenic
1100232406 12:92621564-92621586 AGAGACAAACAGAGATAGGTAGG - Intergenic
1100349075 12:93761455-93761477 TGAGATTAAGAGAGAAATCAAGG + Intronic
1100575857 12:95890951-95890973 GGAGAGAGACAGAGAAAGATGGG + Intronic
1100742591 12:97610108-97610130 TGAAATGAACAGAAGAAGCTGGG + Intergenic
1100775633 12:97970416-97970438 TGAGAGAGAAAGAGAAAGGTAGG - Intergenic
1103096626 12:118137283-118137305 TAAGAGAAACAGATAAGGCTGGG - Intronic
1104651277 12:130536188-130536210 AGAGAGAAACAGAGACAGATAGG + Intronic
1105621248 13:22068781-22068803 TGTGATAAACAACAAAAGCTTGG + Intergenic
1106292771 13:28380657-28380679 TCAGAAGATCAGAGAAAGCTGGG + Intronic
1107541911 13:41396681-41396703 AGAGAGAAAGAGAGAAAGCAAGG + Intergenic
1107554524 13:41506018-41506040 TGAGATAAACTGAGGCTGCTTGG + Intergenic
1108398054 13:50009310-50009332 TGAAATAAACGAAGAAGGCTGGG + Intronic
1108980236 13:56501916-56501938 AGACTTAAACAAAGAAAGCTGGG - Intergenic
1109092954 13:58071694-58071716 GGAGATAAAATGGGAAAGCTTGG - Intergenic
1109170460 13:59090123-59090145 TGAGAAAGACAAAGAAAGGTAGG - Intergenic
1110446446 13:75587946-75587968 TGAGAGCAACAGACAGAGCTAGG - Intronic
1111049444 13:82861226-82861248 TGTGATAAGCAAAGAAATCTGGG - Intergenic
1111781461 13:92731395-92731417 TGAAATAATGAGAGAAAACTGGG + Intronic
1112191145 13:97178960-97178982 TGAGATAAATAGTTGAAGCTGGG + Intergenic
1113380593 13:109801968-109801990 TGAGATAAAATTAGAAAGATTGG + Intergenic
1114257288 14:21014103-21014125 AGAGATAAAGAGAGAAAGAAAGG + Intergenic
1114305591 14:21420084-21420106 TGAGTGAAGGAGAGAAAGCTGGG - Intronic
1114918620 14:27297594-27297616 TGATATAAACAGTGAAATCCAGG - Intergenic
1114951408 14:27759336-27759358 TGAGAAAAACAGAAGAATCTAGG + Intergenic
1115821431 14:37216294-37216316 AGAGATAAAGAGAGAGAGATAGG + Intronic
1116254924 14:42540721-42540743 AAATATAAATAGAGAAAGCTTGG + Intergenic
1116562389 14:46397260-46397282 TGAGATAAGCAGAGGAAGGTAGG - Intergenic
1117439255 14:55744892-55744914 GGAGGTAAACAGAGAAAGCCAGG - Intergenic
1117707012 14:58480806-58480828 TGAGATGACGAGAGAAAACTGGG - Intronic
1117759000 14:59006447-59006469 TGAGACAAAAAGAGAAACCTAGG + Intergenic
1119171851 14:72541631-72541653 AGAGACAAACAGAGAGAGATGGG - Intronic
1119436170 14:74599367-74599389 TGAGATAAAATGAGAAGTCTAGG + Intronic
1119728639 14:76937410-76937432 TCAGATAAGCAGAAACAGCTGGG + Intergenic
1120070636 14:80098708-80098730 TCAGACAAACAGAGAAATATGGG - Intergenic
1120700101 14:87690289-87690311 TGAGGTAAATAGAGAGAGCTAGG - Intergenic
1121270726 14:92636255-92636277 AGAGAGAAAGAAAGAAAGCTTGG + Intronic
1121842962 14:97150033-97150055 TGAGATAAACAGAGGATGTGTGG - Intergenic
1125664897 15:41422698-41422720 TTAGATAAACAGAGAAAAACAGG - Intronic
1128194268 15:65736744-65736766 TGAAATATACAAAGAAAGCCTGG - Intronic
1128249706 15:66155716-66155738 TGAGATAAAGAGAAAAATCAAGG - Intronic
1129550440 15:76443008-76443030 ACAGATAAACAGCGAAAGTTGGG + Intronic
1129621156 15:77147550-77147572 TGAGATAAACACAGAAACACAGG + Intronic
1130411200 15:83650215-83650237 TGAGGTCAACAGGCAAAGCTGGG + Intergenic
1132248753 15:100317663-100317685 TGAGAAAAAGAGACAATGCTTGG + Intronic
1132289259 15:100688140-100688162 AGAGAGAAAGAGAGAAAGCGCGG + Intergenic
1133988396 16:10685724-10685746 AGAGATAAACAGAGACGGGTGGG - Intronic
1134848041 16:17457554-17457576 TGAGTTAAAGACAGAAAGCAGGG - Intronic
1135501952 16:23003670-23003692 TGAGATACACACAGAGAGATTGG + Intergenic
1135934682 16:26769800-26769822 TGAGGAAAAGAAAGAAAGCTGGG - Intergenic
1136176510 16:28520792-28520814 TGACATTTACTGAGAAAGCTTGG - Intergenic
1137425459 16:48376367-48376389 TGAGAAAAAAAGTGAAAGCAAGG - Intronic
1139940289 16:70600770-70600792 TGGGAGAAACAGGGAATGCTGGG + Intronic
1140101606 16:71922450-71922472 TGAGAAAAAAAGAGAAACCCAGG - Intronic
1140570453 16:76099730-76099752 TAAGAAAAACAGAAAAAGCATGG - Intergenic
1140671600 16:77284922-77284944 TGAGATTAACTGAAAAAGCCGGG + Intronic
1141165692 16:81659483-81659505 TCAGGTAAACGGAGCAAGCTGGG + Intronic
1143099184 17:4495952-4495974 TGGGATAAACACAGAAAAGTAGG - Intergenic
1143389722 17:6553127-6553149 TGAGACAGACAGTGAAGGCTGGG - Intronic
1144010080 17:11139373-11139395 TGAGATAAAGAGAGGATTCTGGG + Intergenic
1144329296 17:14210037-14210059 TGAGAAAAACAGACAAGGCTGGG - Intergenic
1145930875 17:28684364-28684386 TGATATAAACAAAGAATGTTTGG - Intronic
1146825433 17:36018561-36018583 TGAGATAAACAGAGGAGTCAAGG - Intergenic
1148085319 17:44990362-44990384 TGAGAGAAACAGAGAGACATGGG + Intergenic
1149037802 17:52155728-52155750 TTAGCTAAACACAGAAAACTAGG - Intronic
1149757538 17:59199969-59199991 AGAGCTAAACAGAAAAAGCAAGG - Intronic
1149801713 17:59574365-59574387 TCAGATAATCAGAAAAAGCTAGG - Intronic
1149844774 17:60001097-60001119 TCAGATAATCAGAAAAAGCTAGG + Intergenic
1150716994 17:67580686-67580708 AGAGAAAAAGAGAGAAAGCAAGG - Intronic
1150981326 17:70145030-70145052 TGTGATGAACTGAGAAAGGTAGG + Intergenic
1151773155 17:76178036-76178058 TGAGATACACAGACAAACATAGG - Intronic
1152001267 17:77646686-77646708 TTATATAAAAAAAGAAAGCTTGG + Intergenic
1152330064 17:79667637-79667659 TGAGATAAACGAAGACAGATGGG + Intergenic
1153466404 18:5392857-5392879 TGAGATACACAAAGCAAGATTGG + Exonic
1153611318 18:6888191-6888213 TGAAATAAAGAGAGAAAAATTGG - Intronic
1153987938 18:10369300-10369322 TCTGGTAAACACAGAAAGCTTGG + Intergenic
1154245967 18:12698979-12699001 TGAAGTACACAGAGAAAGCTTGG - Exonic
1155797693 18:30060398-30060420 AGGGATACACAGAGAAACCTCGG + Intergenic
1155906390 18:31457282-31457304 TGAGAGAAAGAGAGAAAGGAAGG + Intronic
1155971191 18:32085402-32085424 AGAGAGAGAGAGAGAAAGCTGGG + Intergenic
1156278726 18:35611253-35611275 TGAGAAAAAAAGTGAAAGCATGG - Intronic
1157383586 18:47244199-47244221 TGAGACAGAGAGAGCAAGCTAGG - Intronic
1157874789 18:51262011-51262033 TGAAATAAAGAGAAAATGCTAGG + Intergenic
1158613850 18:58968152-58968174 AGAGATAAACAGGAAAAGCCAGG - Intronic
1158936048 18:62365506-62365528 TGAGGCAAACACAGCAAGCTAGG - Intronic
1159878849 18:73839052-73839074 TGAGAAAAAGAAAGAAAGTTGGG + Intergenic
1159896499 18:74001665-74001687 TGAGAAAAACAGAAAAAGTAAGG - Intergenic
1160776302 19:857925-857947 AGAGAAAAACAGAGAAAGGAAGG + Intergenic
1160881499 19:1322905-1322927 AGAGATAAACAGAGACAGAGAGG + Intergenic
1162442002 19:10698501-10698523 TCAGAATAACACAGAAAGCTTGG + Intergenic
1163134645 19:15301042-15301064 TGAGAAATGCAGAAAAAGCTGGG + Intronic
1163596987 19:18226116-18226138 AGAGAGATACAGAGAAAGCGAGG + Intronic
1163619077 19:18347401-18347423 AGAGAGAAACAGAGAAGGATGGG - Intronic
1164712896 19:30371281-30371303 TGACATAAACAAAGGCAGCTGGG + Intronic
1164945343 19:32288561-32288583 TGGGAAAAACAGAGGAAGCAGGG - Intergenic
1165964592 19:39565164-39565186 TGAGATCAAGAGAGCAAGATAGG + Intergenic
1166688048 19:44807968-44807990 TCAGACATACAGAGAAGGCTTGG - Intergenic
1166730874 19:45058327-45058349 TGAGAAAAACAGAGAGACTTGGG - Intronic
1167646697 19:50709863-50709885 TCAGATAAACAGAGAAATTTTGG - Intronic
1168053538 19:53847836-53847858 TGTGATAAAGAAAAAAAGCTGGG - Intergenic
926019928 2:9485867-9485889 TGGGATCCAGAGAGAAAGCTTGG + Intronic
926203648 2:10819547-10819569 TGAGATAAATAGAGTAAGAATGG + Intronic
927335538 2:21919280-21919302 TGACATAAAGAGAAAAATCTGGG - Intergenic
927706928 2:25302189-25302211 GGAGATAGAGAGAGAATGCTCGG + Intronic
928159154 2:28905947-28905969 TGAGATAAACAGGGCAGGCGTGG - Intronic
928454558 2:31407392-31407414 TGAGATAAAAAGAGCTGGCTTGG + Intronic
929085789 2:38166016-38166038 AGAGAGAAATAGAGATAGCTGGG + Intergenic
929307850 2:40385394-40385416 AGAGATTAAAAGAGAAAGGTAGG - Intronic
930210290 2:48629530-48629552 TGAGACAAACAGACCAAGCCTGG - Intronic
931629326 2:64285072-64285094 AGAGAGAAACAGAGGAAGCAGGG - Intergenic
931836863 2:66108322-66108344 TGAGAAAAAGAGAGAGAGGTAGG - Intergenic
932782167 2:74566568-74566590 CAAGAGAAACAGACAAAGCTAGG + Intronic
932991094 2:76788999-76789021 TGAGTTAAACAGCTAATGCTTGG + Intronic
933070520 2:77852282-77852304 TGAAATAAAAAGAGAAATGTAGG - Intergenic
933624061 2:84578622-84578644 GGAGAGAGACAGAGAAAGCCTGG + Intronic
933837839 2:86260173-86260195 TGGGAGAAAAAGAGAAAGCAGGG + Intronic
934485938 2:94710365-94710387 TGAGAAAAACAGAAGAATCTAGG - Intergenic
934986101 2:98885993-98886015 TGAGATAAACAGCCAAATCTCGG + Intronic
935661586 2:105471255-105471277 CTAGAGAACCAGAGAAAGCTTGG - Intergenic
936494102 2:113002884-113002906 TGAGATAAACAGGTCAATCTGGG + Intergenic
937704409 2:124902728-124902750 GGAGATAAAGAGAGATAGATAGG + Intronic
937981372 2:127618036-127618058 AGAGACAAATAGAGAGAGCTAGG - Intronic
939119276 2:138097290-138097312 TGAAATAAATAGAGAAACATAGG - Intergenic
939478981 2:142724900-142724922 TGTGATAAACAGAGCCAGATAGG - Intergenic
939971030 2:148661403-148661425 TAAGAGAATCAGAGAAAACTAGG - Intronic
940032505 2:149279351-149279373 TCAGATGAAAAGAGAAAACTAGG - Intergenic
940619865 2:156097873-156097895 TGACATAAATACAGAAATCTTGG - Intergenic
940639327 2:156330876-156330898 TGAGACAAACAGGGAAGGCATGG - Intronic
941614605 2:167704935-167704957 GGAGAGAAAGAGAGAAAGTTTGG + Intergenic
941616060 2:167721041-167721063 GGAGATATACAGAGAGAGATGGG - Intergenic
942104851 2:172624012-172624034 TGAGAGGAACAGAGAAAGAAAGG - Intergenic
944054743 2:195511990-195512012 AGAGGTAAACAGACAATGCTAGG - Intergenic
944438058 2:199712660-199712682 TGAGAGAATCAGAGAGAGCAGGG - Intergenic
944484732 2:200193072-200193094 TGGGATCAAAAAAGAAAGCTAGG + Intergenic
944717885 2:202393253-202393275 AGAGATAAACAGACAGAGTTTGG + Intronic
945022873 2:205591756-205591778 TGAGATAAAAAGAGAAGGTCTGG + Intronic
945543311 2:211116667-211116689 TGAGATAACCATAGAAATATAGG - Intergenic
945766508 2:213986177-213986199 TGAGGTAGACAGTGAAAGTTGGG + Intronic
946056081 2:216903099-216903121 TGATATAAACAGTGAAATCCAGG - Intergenic
946165385 2:217860340-217860362 TGAGATAAAATGGGACAGCTCGG + Intronic
946211855 2:218153603-218153625 TGAGATGAAAAGATAAAGCTTGG - Intergenic
946980140 2:225204146-225204168 TAAGAAAAACAAAGATAGCTTGG - Intergenic
948049650 2:234969851-234969873 TGAGAGAGACAGAGAAAGAGGGG - Intronic
948929370 2:241122094-241122116 TGTGATACACAGATAAAGCTGGG + Intronic
1168855204 20:1002914-1002936 AGAGAGAAAAAGAGAAAGCCAGG - Intergenic
1169552774 20:6718208-6718230 TGAGCTAAATAGAGATAGCATGG - Intergenic
1169933282 20:10856767-10856789 TGAAATAAAAAGAGGAATCTGGG - Intergenic
1172122836 20:32608726-32608748 TGAGACAGACAAAGAAAGCAGGG - Exonic
1172780676 20:37435357-37435379 TGAGAAAAAGAGAGGGAGCTAGG - Intergenic
1174511321 20:51055335-51055357 TGAGATAGAGAGAGCAAGATGGG + Intergenic
1174858904 20:54071617-54071639 GGAGAGAAATAGAGAGAGCTGGG + Intergenic
1175054353 20:56184815-56184837 TGAGAGAAACAGAGACTCCTTGG - Intergenic
1175752841 20:61510942-61510964 TGAGAGAGAGAGAGAAAGTTGGG + Intronic
1176123668 20:63465537-63465559 CGAAATCAACAGAGAAAGCTCGG + Intronic
1177280731 21:18979662-18979684 ACAGAAAAAGAGAGAAAGCTTGG - Intergenic
1177879049 21:26669997-26670019 TGAGATAAAAATAGAAATGTTGG - Intergenic
1179050453 21:37884666-37884688 TGAGATAAAGATAGAAGGGTAGG - Intronic
1179141245 21:38727367-38727389 TGAGAGAAAGAGAGAAATCAAGG - Intergenic
1179197547 21:39179598-39179620 TGATGTAAACAAAGAAAGATGGG + Intronic
1179461976 21:41542223-41542245 AGAGAGAAAGAAAGAAAGCTAGG + Intergenic
1179956331 21:44741268-44741290 AGAGAAAAACAGTGATAGCTAGG - Intergenic
1181453883 22:23043625-23043647 CCAGATAAACATAGAAAGTTGGG - Intergenic
1183257242 22:36770483-36770505 TTGGATATACAGACAAAGCTTGG - Intronic
1183561044 22:38573239-38573261 TGAGAAAAAAAGAGAAAGTTTGG - Intergenic
1184077287 22:42189899-42189921 TAAGGAAAAGAGAGAAAGCTGGG + Intronic
1184538134 22:45101344-45101366 TGACAGAAAAAGAGAGAGCTGGG + Intergenic
1185295910 22:50054644-50054666 GCAGATAAACAGATAAAGCCGGG + Intronic
949128796 3:476798-476820 TGAGAGAAAGAGAGAAATTTAGG - Intergenic
949943531 3:9172773-9172795 TGACAGTAACAGAGAGAGCTGGG + Intronic
950138859 3:10601581-10601603 TGAGACAGACAGAGAATGCTAGG - Intronic
950241004 3:11369905-11369927 TGAAATTAACAGACAAAGCTGGG - Intronic
950775586 3:15347173-15347195 TGAGAAAAAGAGAGGAAGCAAGG + Intergenic
951588590 3:24239843-24239865 TGACATACACTGAGAAAGTTGGG - Intronic
951706563 3:25549899-25549921 TGAGAGAGAGAGAGACAGCTGGG - Intronic
953447730 3:42981692-42981714 TGAGAGAACGGGAGAAAGCTGGG + Intronic
953947101 3:47159154-47159176 TGAGATTACCAGAGAATCCTTGG - Intronic
954857800 3:53661470-53661492 TGAGAAAAACAGAAATACCTTGG + Intronic
955627839 3:60938152-60938174 TGAGAAAAGCAGAGGAAGCAAGG + Intronic
956308323 3:67850945-67850967 TGAGATAGGTACAGAAAGCTAGG + Intergenic
956556744 3:70532161-70532183 AGAGATAGACAGAGAAAGAAGGG + Intergenic
956667892 3:71659097-71659119 TTATATAGACAGGGAAAGCTAGG + Intergenic
956803350 3:72784036-72784058 AGAGGTTAACAGAGAAACCTGGG + Intronic
957517134 3:81269843-81269865 TGAGAGATACAGAGAAAGGAAGG + Intergenic
959245897 3:103867459-103867481 TCAGAGACACAGAGAAATCTAGG + Intergenic
960784290 3:121355406-121355428 TGAAATAAAGTGAGAAAGCAAGG - Intronic
961097842 3:124173290-124173312 AAAAATAAAAAGAGAAAGCTTGG + Intronic
962267412 3:133953790-133953812 TGAGATAAATGGAGAGAGTTTGG + Intronic
962293034 3:134153501-134153523 TGAAATAAAAAGAGACAGGTTGG - Intronic
962705383 3:138038477-138038499 TGAGAAAAATAAAGAAAGATAGG + Intergenic
963239701 3:142991124-142991146 TTAGAAAAACAGAGAATGTTGGG + Intronic
964073863 3:152669170-152669192 TAAGATAAACAGATAAAGAAAGG - Intergenic
964137620 3:153362748-153362770 AGAAATAAAAAGAGAAAGCCTGG + Intergenic
964517489 3:157528528-157528550 TGAGATAAACAAAGAAGCCAGGG + Intronic
965230112 3:166039615-166039637 AAAGAAAAACAGAGAAAGCCCGG + Intergenic
965493579 3:169369643-169369665 TGAAATAAAAAAAGAAGGCTGGG - Intronic
967121800 3:186388898-186388920 TGAGCTACAAAGAGATAGCTAGG - Intergenic
967216763 3:187217823-187217845 AGAAATAAACAGAATAAGCTGGG + Intronic
967258876 3:187622162-187622184 GGGGCTAAACAGAGAAAGCCAGG + Intergenic
967418286 3:189243872-189243894 TGATATAGACAGTGAAAGCCAGG - Intronic
967420143 3:189263344-189263366 AGAGAAGAACAGAGAGAGCTTGG + Intronic
967863889 3:194174740-194174762 AGAGATGAAGAAAGAAAGCTAGG + Intergenic
968206508 3:196806964-196806986 TGAGATAAACAGAGAAAGCTTGG - Intronic
968377654 4:56859-56881 TGAGCTAAAGGGAAAAAGCTGGG - Intronic
968630486 4:1648371-1648393 TGAGGGACACAGAGAAAGGTGGG + Intronic
971218509 4:24683815-24683837 AAAGATAAACAGAGAAAGTCAGG + Intergenic
971233928 4:24824598-24824620 TGAGATAAACTGTGCATGCTTGG - Intronic
971678981 4:29672518-29672540 TGAAATAAACATAGGAATCTTGG - Intergenic
972607521 4:40627765-40627787 TGAAATAAAGACAGAAAGCAAGG - Intronic
972689039 4:41378761-41378783 TGAGAGAAACAGAGAAATCCAGG + Intronic
973000880 4:44948442-44948464 TGAGAAAAACAGGGAAGGCAGGG - Intergenic
975393300 4:73845992-73846014 TGAGACATTCAGAGAAACCTAGG + Intronic
975562802 4:75723585-75723607 TAAGCTAGACAGAGGAAGCTGGG - Intronic
976381083 4:84399826-84399848 TGAGATAACTGGAGAAGGCTTGG + Intergenic
976742301 4:88368721-88368743 TGAGATAAATATAGAAAGGTTGG + Intergenic
976932422 4:90584425-90584447 TGACAGCAACAGAAAAAGCTTGG + Intronic
977667209 4:99654783-99654805 TGAGATGAAAAGAGAAGGTTGGG + Intergenic
978255579 4:106688966-106688988 AGAAATAAGCAGAGATAGCTAGG - Intergenic
978802554 4:112769477-112769499 TAAGAAAAACAGAGAAACCAAGG - Intergenic
978941155 4:114437276-114437298 TGACAAAAACAGAGGAAGGTTGG + Intergenic
979124227 4:116947202-116947224 TGAGAAAAGCAGAGAAACCTTGG - Intergenic
980648082 4:135671345-135671367 TGAGAGAAAGAGAGAGAGATGGG + Intergenic
981109120 4:140915486-140915508 GGAGAAAAACAGAAAAGGCTTGG + Intronic
981623879 4:146735088-146735110 TGAAATTAAAAGAGAATGCTGGG + Intronic
982819020 4:159923554-159923576 TGAGATAAACTAAGAAAGTAAGG - Intergenic
982925382 4:161331005-161331027 TGAGAAAAACTAAGAAATCTGGG - Intergenic
983125059 4:163940873-163940895 TGAGATAAACATATAAAGTTTGG + Intronic
983292713 4:165826381-165826403 TTAGAAAAACAGAGAAAGGGTGG + Intergenic
983737661 4:171083080-171083102 TCAGATAAAAAGAGAGATCTGGG - Intergenic
984083205 4:175275798-175275820 TGAGCTCAGCAGAGAAGGCTTGG + Intergenic
984272425 4:177563936-177563958 TAAGATAAATAGGGAAAACTGGG - Intergenic
985270796 4:188192951-188192973 TGAGATGAATAGAGAAAGAAAGG + Intergenic
985901410 5:2797922-2797944 TGAGATAAACTGACACAGGTAGG + Intergenic
985975102 5:3413098-3413120 AGACATACACAGAGAGAGCTGGG - Intergenic
986161051 5:5229348-5229370 TGGGATAAATAGAGAACGTTAGG + Intronic
986231916 5:5872856-5872878 CGATATAAATAGAGAAAGCTTGG - Intergenic
986342439 5:6802311-6802333 TTGGATCAACATAGAAAGCTTGG - Intergenic
988927902 5:36007669-36007691 TGATATAAACAGTGAAGGCCAGG - Intergenic
990003383 5:50920886-50920908 TGAGAAAAACACAGAAAGAGAGG + Intergenic
990267508 5:54093372-54093394 TGACATGAACCGAGAAAACTTGG + Intronic
990613631 5:57485048-57485070 TGAGTAAAACATAGAAAGATGGG + Intergenic
990680583 5:58239436-58239458 GGAGAGAAAAATAGAAAGCTAGG - Intergenic
992162531 5:74016815-74016837 TGAGAGAAGCAGAGAAAGAAAGG - Intergenic
992649050 5:78839256-78839278 TCAGGAAAAAAGAGAAAGCTAGG + Intronic
993799282 5:92311219-92311241 TGAGAGAAACAGAGAGAGAGAGG - Intergenic
993974282 5:94457740-94457762 TGAGCTAAAAAGAGTTAGCTGGG + Intronic
994339144 5:98605177-98605199 TGAGATAAACAGTGAAACTATGG + Intergenic
994539558 5:101077247-101077269 TGACAAAAAAAGAGAAAACTTGG + Intergenic
995389593 5:111625931-111625953 TGAGTTAAAGAGATGAAGCTGGG + Intergenic
995793367 5:115917193-115917215 TGAACTAAACAGAGAAGGCGGGG - Intergenic
995931279 5:117448927-117448949 TGAGAAAAATAGATGAAGCTTGG + Intergenic
996131447 5:119786369-119786391 TGAGAAAAACAAAAAAAACTTGG - Intergenic
996414455 5:123195160-123195182 TTAGATAAAGAGAGAAATCAGGG + Intergenic
996469783 5:123846217-123846239 AAAGATAAACAGAGAAAAATAGG + Intergenic
997010877 5:129875845-129875867 TGAGTTACACAGACAAATCTAGG - Intergenic
997016308 5:129938820-129938842 TGAGAAAATGAGAGAAAGTTTGG - Intronic
998319722 5:141217844-141217866 TGAGAGAGAGAGAGAAAGCATGG + Exonic
999263411 5:150251494-150251516 AGAGAGAAACAGAGAAACCCTGG + Intronic
999924270 5:156358096-156358118 TGAGAGAAAGAGAGAAAACATGG - Intronic
1000070064 5:157732091-157732113 TCAGAAAAAAAGAGAAGGCTGGG + Intronic
1000477432 5:161728490-161728512 AGAGCTCAACAGAGAAATCTAGG + Intergenic
1001560213 5:172664016-172664038 TGAAACAAGCAGAGAAGGCTTGG + Intronic
1003012197 6:2436437-2436459 TAAGAAAAACAGAGAAAGCTGGG + Intergenic
1003112471 6:3261347-3261369 TGGGATAAAGAGAGAATGCGAGG - Intronic
1003811698 6:9789632-9789654 AATGATAAACAGAGAAATCTTGG + Intronic
1003967545 6:11267521-11267543 TGATATTAGAAGAGAAAGCTGGG + Intronic
1004063231 6:12218563-12218585 TGAGATAAAAAGAGGAATCAAGG - Intergenic
1004076949 6:12352322-12352344 TGATATGAACAGTGAAGGCTAGG - Intergenic
1004192776 6:13478636-13478658 TGGTACAAACAGAGACAGCTGGG + Intronic
1004597728 6:17116369-17116391 TGAGACATAGAGAGAAAACTGGG - Intronic
1005385757 6:25282508-25282530 TGAGATAAAGAGTGAAAACGGGG - Intronic
1006688476 6:35858733-35858755 TGACATAAACCAAGAAAGATAGG + Intronic
1006894276 6:37456918-37456940 TGAGGTTAAGAGATAAAGCTAGG + Intronic
1007094397 6:39204534-39204556 TGAGATCATCTGAGAGAGCTTGG + Intronic
1008693962 6:54012456-54012478 TGAGACAACCAGAAAGAGCTGGG + Intronic
1008829770 6:55744042-55744064 AGAGAGAAAGAGAGAAAGCGGGG - Intergenic
1008831917 6:55774909-55774931 TGAAATAAACATAGAAATTTTGG + Intronic
1008862550 6:56167299-56167321 TAAGATAAACACAGAAAACCTGG - Intronic
1009370387 6:62893641-62893663 TGAGATGCCAAGAGAAAGCTAGG + Intergenic
1010799166 6:80153919-80153941 GGAGATAAAGATAGAAAGTTTGG - Intronic
1010824968 6:80462012-80462034 TGAAATAAACAGAAAGGGCTAGG - Intergenic
1011224306 6:85090128-85090150 TGAGGCAAGCAGAGACAGCTGGG - Intergenic
1011328189 6:86173855-86173877 TGAGATAAACAGTGGAGTCTAGG + Intergenic
1011780746 6:90786622-90786644 TGAAATAAACAGACATTGCTAGG - Intergenic
1012644538 6:101662406-101662428 TGACTTAAACAGAAAAATCTAGG - Intronic
1012697596 6:102408012-102408034 TGAGATAAACAGATAAATTAGGG + Intergenic
1013686974 6:112596340-112596362 TGAGATCATCAGAGAGAGCTTGG - Intergenic
1013701767 6:112779595-112779617 TGATATGAACAGACAAAGCCTGG + Intergenic
1013898922 6:115128697-115128719 TGGGATAAACAGAGACAGAATGG + Intergenic
1015292035 6:131548109-131548131 TGAGATGCAGAGAGAAAACTTGG + Intergenic
1016729549 6:147414145-147414167 TTAGATAAAGAAAGAAATCTAGG + Intergenic
1017644929 6:156530662-156530684 ACAGAAAAACAGAGAAAGCAAGG + Intergenic
1017728010 6:157288958-157288980 TCAGGCAAACTGAGAAAGCTTGG - Intergenic
1020260829 7:6529934-6529956 AGAGAGAGAGAGAGAAAGCTGGG - Intronic
1020992862 7:15222751-15222773 TGAGACAGAGAGAGAAAGATAGG - Intronic
1021003887 7:15369405-15369427 TGAGTTAAAGAGAGAACACTAGG - Intronic
1021363243 7:19743463-19743485 TGATACAAACAGAGAGAGCATGG - Intronic
1021461579 7:20893414-20893436 TGATGTAAACAGAGAAGGTTGGG - Intergenic
1022059935 7:26783397-26783419 AGAGATAATCAGAGAAATATTGG - Intronic
1023532296 7:41171258-41171280 TAAGAGAAACAAAGAAAACTTGG + Intergenic
1024100174 7:46024346-46024368 TGAGACAAATAGAGCAAACTAGG - Intergenic
1024115190 7:46186216-46186238 AAATATAACCAGAGAAAGCTAGG - Intergenic
1024174016 7:46819873-46819895 AGAGATAAAGAGAAAACGCTGGG + Intergenic
1024627935 7:51224514-51224536 TGAGAAAAAGAGACAAAGCCTGG + Intronic
1025064476 7:55841437-55841459 TTAGATACACAGACAAGGCTGGG + Intronic
1026134828 7:67650727-67650749 TGACATGAACTGAGAAAGTTTGG + Intergenic
1026236583 7:68532532-68532554 TGAGAGAAAGAGAGAAAGGAAGG - Intergenic
1026837530 7:73648361-73648383 AGAGAGAAAGAGAGAAAGCGGGG - Intergenic
1028091983 7:86714149-86714171 AGAGATAACTGGAGAAAGCTAGG - Intronic
1028455340 7:91032259-91032281 TGAAGTAAACAGAAAAATCTGGG - Intronic
1028596707 7:92553690-92553712 GGAAATAAAGACAGAAAGCTGGG + Intergenic
1028619295 7:92806214-92806236 TGAGATAAACCTAGATAGTTGGG + Intronic
1029534616 7:101149370-101149392 TGAGATAAATAAAGCAGGCTGGG - Intergenic
1030191292 7:106812802-106812824 TGAGATAAAAGGAGAATGATGGG - Intergenic
1030213920 7:107023561-107023583 TGAGAGAAAGAGAGAGAGCAAGG - Intergenic
1030369358 7:108680104-108680126 AGAGATAAACAGAGAGAGAGAGG - Intergenic
1030603750 7:111617183-111617205 TGAGAAAAACAGAGTGAGCAAGG - Intergenic
1031967974 7:128041842-128041864 TGAGGTAAACATTGAAAGATGGG - Intronic
1032205042 7:129856139-129856161 TGAGAATCACAGAGAAAGGTTGG - Intronic
1032367048 7:131309107-131309129 TAAGATACACAGGGAAAGCCTGG - Intronic
1032945566 7:136848313-136848335 TTAGAGAAAAAGAGAAATCTAGG + Intergenic
1032993155 7:137416090-137416112 AGAGAGAAACAGAGAAAGAAAGG + Intronic
1033024538 7:137759786-137759808 AGAGAGAAACAGAGAAAGAAAGG - Intronic
1033212506 7:139470494-139470516 TTAGAAAAACAGAAAAAGCCAGG + Intronic
1035832690 8:2714839-2714861 TGAGATAAATAGATTAAACTGGG - Intergenic
1036761305 8:11510606-11510628 AGAGACAGAGAGAGAAAGCTGGG - Intronic
1037147865 8:15595135-15595157 TGAGAAAAATACGGAAAGCTGGG + Intronic
1037499321 8:19470216-19470238 GGATACAAATAGAGAAAGCTTGG + Intronic
1038069235 8:23995083-23995105 TGACAGGAACAGAGAGAGCTTGG + Intergenic
1038387295 8:27160654-27160676 TGAGAGAAAGAGAGGAAGCAAGG - Intergenic
1038690492 8:29757972-29757994 TGACAAAAACAGAGAAGGCAAGG + Intergenic
1038776056 8:30531669-30531691 TAAGATAAACAGTGAAAACTTGG - Intronic
1039898861 8:41736104-41736126 TGAGTTTATTAGAGAAAGCTAGG + Intronic
1040578652 8:48676921-48676943 TGGGTTAAACATAGTAAGCTTGG + Intergenic
1040596671 8:48845046-48845068 TGAGAGAAAGGGAGATAGCTGGG + Intergenic
1041474357 8:58247559-58247581 TGAGATAAAGAGAAAATGCATGG + Intergenic
1041723004 8:60993204-60993226 TGAGATCTAGAGAGCAAGCTGGG - Intergenic
1041861032 8:62512562-62512584 TGAGATTAAGAGAGGCAGCTGGG - Intronic
1042618327 8:70674595-70674617 TGACAAATACAGTGAAAGCTTGG + Intronic
1042666047 8:71207554-71207576 TGAAATAAAAATGGAAAGCTAGG + Intronic
1044086071 8:87943546-87943568 TGGGAGAAAGTGAGAAAGCTTGG + Intergenic
1044166848 8:88995241-88995263 TATGATAAAGAGAGAAAGCAAGG + Intergenic
1044408276 8:91855607-91855629 TGAGACAGACACAGAAAGGTAGG - Intergenic
1044954796 8:97468768-97468790 GTACATACACAGAGAAAGCTAGG - Intergenic
1044963703 8:97555666-97555688 CGAGATAAATAGGGAAAGATGGG + Intergenic
1045139502 8:99265141-99265163 TGGGGTAAACAGACAAAGCCAGG - Intronic
1045584314 8:103514418-103514440 TGAGATAAACTGGGAAAGATTGG + Intronic
1045758037 8:105568987-105569009 TGAGATGAAGAGAGATAGGTGGG - Intronic
1046364149 8:113204169-113204191 TAAGATAAACTGGAAAAGCTTGG - Intronic
1046527410 8:115398196-115398218 TGAGAAAAAAGGAGACAGCTAGG + Intergenic
1046638045 8:116694951-116694973 TGGGATAAACAGAGGAAGTATGG - Intronic
1046846800 8:118925849-118925871 AGAGAGAAACAGAGAGAGATAGG - Intronic
1046992521 8:120475254-120475276 TAAGGTAAAAAGATAAAGCTAGG - Intronic
1047145748 8:122197404-122197426 TGAGAGAAACATATACAGCTGGG + Intergenic
1047392853 8:124467758-124467780 TGAGAAAAACAGCTAAATCTTGG + Intergenic
1048219183 8:132525938-132525960 TGAGAGAAATAGAGAGGGCTGGG - Intergenic
1050426841 9:5519857-5519879 TGAGAAAAAGAGGGAAATCTGGG - Intronic
1050751478 9:8943411-8943433 TGAGATAAAAAGAGACAAATAGG + Intronic
1051063129 9:13068729-13068751 AGAGATGAATAGAGAAAGCATGG + Intergenic
1051202607 9:14644934-14644956 TCATATAAACAGAGCAAGGTAGG + Intronic
1051691841 9:19722336-19722358 TGAGCTGAACTGAGAATGCTAGG + Intronic
1052460353 9:28754924-28754946 AGAAATAAACAGATAAGGCTGGG - Intergenic
1053362827 9:37501482-37501504 TGAGGCAGATAGAGAAAGCTGGG - Intronic
1053671851 9:40373960-40373982 TGAGAAAAACAGAAGAATCTAGG + Intergenic
1053921664 9:43000322-43000344 TGAGAAAAACAGAAGAATCTAGG + Intergenic
1054382967 9:64514008-64514030 TGAGAAAAACAGAAGAATCTAGG + Intergenic
1054512769 9:66002350-66002372 TGAGAAAAACAGAAGAATCTAGG - Intergenic
1055052880 9:71997256-71997278 AAAGATAAGGAGAGAAAGCTAGG - Intergenic
1055122997 9:72684827-72684849 TGAGAGAAATAGAGAAATCAAGG - Intronic
1055598072 9:77885753-77885775 TGAGATTGAAAGAGAAAACTAGG + Intronic
1055762105 9:79620098-79620120 TGAGACATACAGATAAAGGTTGG - Intronic
1055892414 9:81137352-81137374 TAAGAAAAAGAGAGAAATCTGGG - Intergenic
1055892577 9:81139176-81139198 TAAGAAAAAGAGAGAAATCTGGG - Intergenic
1055995291 9:82151084-82151106 TGAGTTAAGGAGACAAAGCTGGG + Intergenic
1056450134 9:86708862-86708884 TCAGATAAGCAGAGAAAGTCAGG - Intergenic
1056511068 9:87306333-87306355 TCAGATAAACAGAGGATGTTTGG - Intergenic
1058140160 9:101349183-101349205 TGAGAAACACAGAAAAAGGTAGG + Intergenic
1058380835 9:104375479-104375501 GGAGATAAACAGAGTAAACTGGG - Intergenic
1058568720 9:106316514-106316536 AGCCATAAACATAGAAAGCTGGG - Intergenic
1058791977 9:108456871-108456893 TTAGATAAACGGAAGAAGCTTGG + Intergenic
1059780554 9:117521873-117521895 AGCCATAAACAGAGGAAGCTGGG - Intergenic
1060329770 9:122656509-122656531 TGAGATACAGAGAGGAAGTTGGG - Intergenic
1203571583 Un_KI270744v1:137388-137410 TGAGCTAAAGGGAAAAAGCTGGG + Intergenic
1186220889 X:7348155-7348177 TGAGAAAGACAGGGAAAGCGAGG - Intronic
1186295944 X:8148605-8148627 TTAGATAAACAGAGAGAGTAAGG - Intergenic
1186403267 X:9279049-9279071 AGAGAGAAACAGAAAAAGCTTGG - Intergenic
1186528409 X:10270747-10270769 GGGGATAAACAGAGAAGGATTGG + Intergenic
1186546981 X:10460220-10460242 TGGGATAAACAGAGTATCCTAGG - Intronic
1188139542 X:26532350-26532372 TATGATAAACAGTGAAAGATGGG - Intergenic
1188216180 X:27480281-27480303 TGAGAAAATTAGAGAATGCTTGG + Intergenic
1188883741 X:35523692-35523714 AGACGTTAACAGAGAAAGCTGGG + Intergenic
1189266956 X:39724502-39724524 TGAGGAAAACAGAGGAAGCAGGG - Intergenic
1189769350 X:44408053-44408075 AAAAAAAAACAGAGAAAGCTGGG - Intergenic
1190259517 X:48789360-48789382 TCATAGAAACACAGAAAGCTGGG + Intronic
1190391078 X:49932215-49932237 TGAGTTAAAAAGAGAGAGATGGG - Intronic
1190972605 X:55366238-55366260 TGAGATAATCAGAGAAACTCTGG - Intergenic
1191879729 X:65833347-65833369 TGAGATAAACATACTCAGCTAGG - Intergenic
1191926603 X:66318050-66318072 TGAGAAAAACGAAGAAAGATAGG - Intergenic
1191947338 X:66550016-66550038 TGAGATAATCAGAGAAATGTAGG - Intergenic
1193062205 X:77219052-77219074 TGAGAAAAAGAAAGAAATCTTGG + Intergenic
1193886795 X:86992951-86992973 TGAAATAAAAATAGGAAGCTAGG - Intergenic
1194224091 X:91233450-91233472 TATGAGAAAGAGAGAAAGCTTGG + Intergenic
1194772519 X:97922464-97922486 TGAAATAAAGAGAGAAAACAAGG + Intergenic
1194914591 X:99689948-99689970 TAAGATAAAGAGAGAAATCAAGG + Intergenic
1195632395 X:107071161-107071183 AAAGATAAACAGAGAAAAATGGG + Intronic
1197552305 X:127906787-127906809 TGAGATAAACAGACAAAATCAGG - Intergenic
1197640066 X:128958043-128958065 GGAGACAAATATAGAAAGCTAGG - Intergenic
1197751055 X:129963822-129963844 AGAGAGAAAGAGAGAAAGCGAGG + Intergenic
1198061761 X:133052948-133052970 TCAGAGAACCAGAGAAAGCAGGG + Intronic
1198495121 X:137184642-137184664 GGAGAGAGACAGAGAATGCTGGG + Intergenic
1199302224 X:146226448-146226470 TGCCATAAACAGAGAAAATTTGG - Intergenic
1199405479 X:147453849-147453871 TGTCATAAACAGAAAATGCTAGG - Intergenic
1199628018 X:149758289-149758311 CGAGGGAAACAGAGGAAGCTGGG + Intergenic
1200448047 Y:3288983-3289005 TGAGATGAACTTAGAGAGCTGGG - Intergenic
1200560555 Y:4696817-4696839 TATGAGAAAGAGAGAAAGCTTGG + Intergenic
1200732719 Y:6759575-6759597 TGAGATAAGGAAAGAAATCTAGG - Intergenic
1200736305 Y:6800094-6800116 AGAGATAAACAAAGAAGGCATGG + Intergenic
1201282923 Y:12356759-12356781 TGAGATAAACAGAGGAAAAAGGG - Intergenic
1201762230 Y:17553215-17553237 CTAGATAAATAGAGAAAGTTGGG + Intergenic
1201839322 Y:18352773-18352795 CTAGATAAATAGAGAAAGTTGGG - Intergenic