ID: 968213517

View in Genome Browser
Species Human (GRCh38)
Location 3:196868487-196868509
Sequence GGACCCTTTTCCAGAGAGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 160}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968213507_968213517 15 Left 968213507 3:196868449-196868471 CCTCCTTCCGGCCTTCGTTTCTT 0: 1
1: 0
2: 10
3: 179
4: 1989
Right 968213517 3:196868487-196868509 GGACCCTTTTCCAGAGAGCCCGG 0: 1
1: 0
2: 2
3: 23
4: 160
968213509_968213517 8 Left 968213509 3:196868456-196868478 CCGGCCTTCGTTTCTTTCCTCGC 0: 1
1: 0
2: 3
3: 39
4: 813
Right 968213517 3:196868487-196868509 GGACCCTTTTCCAGAGAGCCCGG 0: 1
1: 0
2: 2
3: 23
4: 160
968213510_968213517 4 Left 968213510 3:196868460-196868482 CCTTCGTTTCTTTCCTCGCGCTC 0: 1
1: 0
2: 0
3: 12
4: 251
Right 968213517 3:196868487-196868509 GGACCCTTTTCCAGAGAGCCCGG 0: 1
1: 0
2: 2
3: 23
4: 160
968213508_968213517 12 Left 968213508 3:196868452-196868474 CCTTCCGGCCTTCGTTTCTTTCC 0: 1
1: 0
2: 2
3: 256
4: 3469
Right 968213517 3:196868487-196868509 GGACCCTTTTCCAGAGAGCCCGG 0: 1
1: 0
2: 2
3: 23
4: 160
968213506_968213517 23 Left 968213506 3:196868441-196868463 CCGCTCTGCCTCCTTCCGGCCTT 0: 1
1: 0
2: 6
3: 126
4: 2059
Right 968213517 3:196868487-196868509 GGACCCTTTTCCAGAGAGCCCGG 0: 1
1: 0
2: 2
3: 23
4: 160
968213513_968213517 -9 Left 968213513 3:196868473-196868495 CCTCGCGCTCCCCGGGACCCTTT 0: 1
1: 0
2: 0
3: 6
4: 106
Right 968213517 3:196868487-196868509 GGACCCTTTTCCAGAGAGCCCGG 0: 1
1: 0
2: 2
3: 23
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968213517 Original CRISPR GGACCCTTTTCCAGAGAGCC CGG Intronic