ID: 968222916

View in Genome Browser
Species Human (GRCh38)
Location 3:196951680-196951702
Sequence AGAGCAGCAGCCTCTCTCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 331
Summary {0: 1, 1: 0, 2: 2, 3: 34, 4: 294}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968222916 Original CRISPR AGAGCAGCAGCCTCTCTCTC TGG (reversed) Intronic
900350179 1:2230564-2230586 AGGCCAGCAGCCTCCCTCTCCGG - Intronic
900410363 1:2509899-2509921 CCAGCAGCAGCCTCTCTTCCTGG + Exonic
900414641 1:2529413-2529435 AGAGGAGCAGGCTCGCCCTCTGG + Exonic
900708213 1:4093975-4093997 AGACCTGCAGTCTCTCCCTCGGG - Intergenic
901473493 1:9473461-9473483 AGAGCAGCAGCCTGTGGCCCTGG - Intergenic
901794875 1:11674408-11674430 GGAGAAGCAGCCCCTCTCCCAGG + Intergenic
902121178 1:14167352-14167374 AGAGCACAAGCATCTCTATCTGG + Intergenic
902235769 1:15056344-15056366 AAAGCAGCTGCCTCTCCCACTGG - Intronic
902727170 1:18344898-18344920 GGAGCAGCAGCCTGGCTCCCTGG - Intronic
903235090 1:21944923-21944945 ATAGCATGAGCGTCTCTCTCTGG + Intergenic
903449219 1:23441547-23441569 AGAGCAGTAGCCTCACTCTGTGG + Intronic
904124840 1:28230992-28231014 AAAGCAGAAGCATCTTTCTCAGG - Intronic
905087704 1:35397520-35397542 AGAGAAGAAGACTCTATCTCAGG + Exonic
905476213 1:38230022-38230044 AGAGCAACAGTCTCTTTATCTGG - Intergenic
905974456 1:42164723-42164745 AGAACAGCCACCCCTCTCTCGGG - Intergenic
908791413 1:67786396-67786418 AGAGCCCCATCCTCTCTATCTGG - Intronic
911591366 1:99751998-99752020 AGAGCAGGGACCTCTCTCTTAGG + Intronic
912305358 1:108560815-108560837 ACAGAAGCATCCTCCCTCTCTGG - Intronic
912683419 1:111743367-111743389 GGAGCTGCACCCTCTCTGTCAGG - Intronic
914446531 1:147755436-147755458 TGAGAAGCAGCCCCACTCTCAGG + Intergenic
914747317 1:150509920-150509942 AGTGCAGCCCCCTCCCTCTCAGG + Exonic
916484834 1:165249474-165249496 AGAGCAGCTGCCCCTCCTTCAGG + Exonic
918065081 1:181095110-181095132 CCAGCAGCAGCCTCTATCACCGG + Intergenic
920100995 1:203516961-203516983 AGAACAGCAGCCATTCTCTCTGG + Intergenic
920232361 1:204479214-204479236 AGAGCAGCCACATCTCTGTCTGG + Intronic
920564095 1:206960119-206960141 AGTGCATCACCCCCTCTCTCCGG + Intronic
920773982 1:208917809-208917831 TAAGCAGCAGGCTTTCTCTCTGG - Intergenic
921724257 1:218506933-218506955 ACAGCAGCACCCACTCTCTGTGG - Intergenic
922642316 1:227246197-227246219 AGAGGAGGAGCGTCTCTCTGTGG - Intronic
924931114 1:248733219-248733241 AGAGCTGCAACCACTCACTCAGG + Intronic
1063629138 10:7718094-7718116 AGAGCTGCACTCTCTCTCTCTGG + Intronic
1063847714 10:10149743-10149765 AGGACAGCAGCTTCTCACTCTGG + Intergenic
1064949403 10:20830968-20830990 AGAGCTACAGCCTCTCTGTCGGG - Intronic
1065641946 10:27792001-27792023 AAAGCATCAGACTCTCCCTCTGG - Intergenic
1066352701 10:34651477-34651499 AGAGCAGTAGTCTCTGTCTAGGG - Intronic
1066551628 10:36564918-36564940 AGAGCGCCAGCCTCTCTCAGAGG - Intergenic
1069080973 10:64087863-64087885 TGACCAGCAGCCTCTTTCTTTGG - Intergenic
1069877357 10:71571329-71571351 AGGGCAGCTGCCACCCTCTCTGG - Intronic
1069896868 10:71685493-71685515 TGACCAGCAGCCTCCCTCCCTGG + Intronic
1070526767 10:77302239-77302261 AGAGAAGCAGCCCCTTTCCCAGG - Intronic
1070983499 10:80668637-80668659 AGAAAATCAGCCTCTCACTCAGG + Intergenic
1071498697 10:86188606-86188628 ACAGCACCTCCCTCTCTCTCGGG + Intronic
1072361525 10:94664100-94664122 AGAGCAGCTGCCCCTCCCCCTGG + Intergenic
1074853684 10:117458000-117458022 AGAGGAGAAGCCTCACTCACAGG + Intergenic
1074962500 10:118460348-118460370 AGAGCAGAAGGCCCTCACTCAGG + Intergenic
1075275151 10:121086424-121086446 AGAGTGCCAGCCTCACTCTCAGG - Intergenic
1075524235 10:123169161-123169183 ACACCTGCAGCCTCTCGCTCTGG - Exonic
1075547265 10:123364332-123364354 AGGCCAGGAGCCACTCTCTCAGG - Intergenic
1077328178 11:1972593-1972615 AGGGCAGCACCCTCTGTTTCCGG + Intronic
1077549868 11:3195411-3195433 AGAGCAGCTTCCTCTCTTCCCGG - Intergenic
1078432960 11:11301803-11301825 AGAGCGGGAGCCCCTCCCTCAGG + Intronic
1078668925 11:13348092-13348114 AGAGCTGTATCCTCTCTCCCTGG - Intronic
1079077730 11:17394343-17394365 AGAACAGCTGCCTCTGTCCCTGG + Exonic
1079766496 11:24399995-24400017 AGAGTAGCAGCCTCTCTTTAAGG + Intergenic
1080766961 11:35305952-35305974 GGAGCAGGAGGCTCTCTCTGGGG - Intronic
1080776687 11:35393289-35393311 AGAGCAGCAGCCTCTCTGTAAGG + Intronic
1083782734 11:64926398-64926420 ACAGCTGCTGCCTCCCTCTCAGG - Intronic
1084009739 11:66340852-66340874 AGAGCAGCAGCTTCTCACTCTGG + Exonic
1084128489 11:67117030-67117052 AAAGCAGCAGTCTCTCACACTGG - Intergenic
1085192551 11:74640692-74640714 AGAGCAGCAGTCCCTTTCTTGGG - Exonic
1085514035 11:77102142-77102164 TGAGCATCAGACTCACTCTCAGG - Intronic
1086133968 11:83428495-83428517 AGAGCATCAGCCACTCTGTTGGG - Intergenic
1086726642 11:90193825-90193847 AGAGGAACAGTATCTCTCTCAGG - Intergenic
1087912019 11:103764952-103764974 ATGGCATCTGCCTCTCTCTCAGG - Intergenic
1088356060 11:108944885-108944907 AAAGCACCAGCCTCCCTCACAGG - Intergenic
1088408980 11:109512699-109512721 AGGGCACCAGCTTCTCCCTCAGG + Intergenic
1089459088 11:118642250-118642272 GGAGCAGCAGCTTCTCCATCTGG - Exonic
1089776418 11:120840028-120840050 CGAGCAGCCTCCGCTCTCTCTGG - Intronic
1090408929 11:126494662-126494684 AGAGAGGCAGCTTCCCTCTCTGG - Intronic
1091285507 11:134406368-134406390 AAAGCATCAGCCCCTCTATCTGG + Intronic
1202811157 11_KI270721v1_random:27773-27795 AGGGCAGCACCCTCTGTTTCCGG + Intergenic
1095361773 12:41350854-41350876 CCAGAAGCAGCCTCCCTCTCAGG + Intronic
1096088662 12:48883624-48883646 AGATCAGCCTCCTCTCTCCCTGG + Intergenic
1096156813 12:49345658-49345680 AGGGCAGAAGCCTCACTCACGGG + Intergenic
1096231343 12:49898454-49898476 AGAGGGCCAGCCACTCTCTCTGG + Intronic
1096629539 12:52917034-52917056 GGAGCAGAAGTCTCTCTCTGGGG - Intronic
1096807317 12:54148680-54148702 AGAGGAGCAGCCAGGCTCTCGGG - Intergenic
1097813052 12:64039391-64039413 AGCGCAGTATCCTTTCTCTCAGG + Intronic
1098594990 12:72262068-72262090 AGAGCAGAAGCTCCCCTCTCAGG + Intronic
1099781668 12:87202999-87203021 CAAGCAGGAGTCTCTCTCTCTGG - Intergenic
1100577395 12:95906389-95906411 CGAGCAGAAACCTGTCTCTCTGG + Exonic
1101579265 12:106027197-106027219 AGACAAGCTGCATCTCTCTCTGG - Intergenic
1102203612 12:111075128-111075150 ACAGGAGCAGCCGCTCTCCCTGG + Intronic
1103164989 12:118762782-118762804 AGAGCAGCATTGTCTCCCTCAGG + Intergenic
1103637952 12:122324285-122324307 AGAGAAGCAGCTTCTTTCTCAGG - Intronic
1103884699 12:124191664-124191686 AGAGTAGCCGTCTCTCTTTCAGG + Intronic
1103901484 12:124305857-124305879 GGAGCAGCTGCCTCTCTTTTGGG + Intronic
1104493803 12:129218001-129218023 GGACCAGCAGCCTCTCTCCCTGG + Intronic
1104651171 12:130535141-130535163 AGAGCAGCAGCTGCTCACTAAGG - Intronic
1105776808 13:23669958-23669980 AGAGCAGCAACCTCTTTGTGGGG - Intronic
1107438348 13:40402143-40402165 AGAACTGCAGTTTCTCTCTCTGG - Intergenic
1107667443 13:42705958-42705980 AGATCGGCAGCCTCGCTTTCAGG - Intergenic
1110963521 13:81660921-81660943 AGAACAGGAGACTCTCTCTGGGG - Intergenic
1111693071 13:91589482-91589504 TGACCATCACCCTCTCTCTCTGG + Intronic
1111816817 13:93164140-93164162 AGAACATCAGCCTGTGTCTCAGG + Intergenic
1113056532 13:106273998-106274020 ACAGCAGCAGCCTCGATTTCAGG - Intergenic
1114660189 14:24338894-24338916 ATAGGCGTAGCCTCTCTCTCTGG - Intronic
1118930229 14:70234380-70234402 GCAGCAGCAGCTGCTCTCTCCGG - Intergenic
1119943202 14:78663481-78663503 AGAGCAGCATCTTCCCTCTCAGG - Intronic
1119996231 14:79256705-79256727 AGAGCAGGTGGCTTTCTCTCGGG + Intronic
1122123222 14:99565645-99565667 AGAGCTGCCTCCTCTCTCCCTGG + Intronic
1122326204 14:100882077-100882099 AGCGCAGCAGGCTCTCTTGCCGG + Exonic
1122393981 14:101409693-101409715 AGAGCAGGTGGCTTTCTCTCAGG - Intergenic
1122805099 14:104252523-104252545 TACGCAGCAGCCTCTGTCTCAGG + Intergenic
1123025544 14:105421966-105421988 AGACCAGCAGCATCTCTGCCAGG - Intronic
1124151200 15:27179963-27179985 AGAGCTGCAGCACTTCTCTCTGG + Intronic
1125372499 15:38993567-38993589 AGAGCAGAAACCTCTCTCAAAGG + Intergenic
1125611851 15:40976732-40976754 AGTCCAGGAGCCTCTCCCTCAGG + Intergenic
1125902961 15:43366280-43366302 GAAGCAGCAGCCTCTCACTCTGG - Exonic
1128935667 15:71744482-71744504 AGAGCAGCTGCCTCCCCCTTTGG - Intronic
1129189563 15:73929423-73929445 TGAGCAGCAGCCCCTCACTGAGG - Intronic
1129613831 15:77082544-77082566 AAAGCAGGAGACTGTCTCTCTGG - Intronic
1129771773 15:78207318-78207340 AGACCAGCTGCCGCTCTCCCAGG - Intronic
1129856399 15:78828358-78828380 AGAGCTGAAGGCTTTCTCTCTGG + Intronic
1130087190 15:80787487-80787509 TGATCAGCAGCATCTCTTTCTGG + Intronic
1130108212 15:80944876-80944898 CGAGCAGCAGCACCTCTCTGGGG + Intronic
1132572495 16:650064-650086 AGAGCAGCACCCAGTCTCTGGGG + Exonic
1133908730 16:10045379-10045401 TGTACAGCAGGCTCTCTCTCAGG + Intronic
1136525186 16:30825158-30825180 AGAGCACCTGCCCCTCCCTCTGG + Intergenic
1139290612 16:65855023-65855045 AGAGCAAGACCCTCTCTCTCAGG + Intergenic
1139368370 16:66447932-66447954 AGAGCAGCAGGCTCCCTCCTGGG - Intronic
1140151654 16:72373317-72373339 AGAACAGCAGACTGTCTCTGGGG - Intergenic
1141143486 16:81513287-81513309 AGAGGAGCCGCCTTTCTCTTGGG + Intronic
1141850031 16:86638851-86638873 AAAGCAGCAGGCTCACCCTCTGG + Intergenic
1141938138 16:87255499-87255521 AGAGCGGCACCTTCTCTCTCGGG + Intronic
1148133215 17:45274677-45274699 ACAGCAGCAGCCTCTGTGTGTGG - Intronic
1149232775 17:54554635-54554657 AAAGCAGCACCCTGCCTCTCAGG - Intergenic
1149644864 17:58233015-58233037 GGAGCAGCAGCCTGCCTCACAGG - Intronic
1149986774 17:61353392-61353414 TGAGCAGCTGCCTTTCTCACAGG + Intronic
1151577334 17:74959301-74959323 AGAGCAGCAGCCTTGCTCAAGGG - Intronic
1152279726 17:79378311-79378333 AGAGCAGCTGACTCCCTTTCTGG + Intronic
1152386288 17:79976852-79976874 GGAGCAGCAGCCTCCACCTCTGG - Intronic
1152386390 17:79977345-79977367 GGAGCAGCAGCCTCCACCTCCGG + Intronic
1152661925 17:81546430-81546452 AGCGCAGCTGCCTCCCTCCCCGG + Intronic
1152684091 17:81685282-81685304 AGTGAATCAGCCTCTGTCTCTGG + Intronic
1152938046 17:83152119-83152141 AGGTCAGCTGCGTCTCTCTCTGG + Intergenic
1153615626 18:6930315-6930337 AGAGCACCAGCCCCTGTATCAGG - Intergenic
1153962993 18:10155584-10155606 AGAGCAGCAGCCTCTCAGCCTGG + Intergenic
1155588473 18:27396777-27396799 AGAGTAAAAGCCTTTCTCTCTGG + Intergenic
1156497995 18:37538434-37538456 AGGCCTGGAGCCTCTCTCTCTGG + Intronic
1159080677 18:63731823-63731845 AGAGGAGGAGCCTCTCCCTGTGG - Intergenic
1159922371 18:74237588-74237610 AGAGGAGCTGACTCTCGCTCCGG + Intergenic
1161346315 19:3770457-3770479 AACCCAGCAGCCTGTCTCTCTGG + Exonic
1163314910 19:16535268-16535290 TGAGAAGCAGCCTCTGTGTCTGG + Intronic
1163783797 19:19264137-19264159 AGAGCAGGAACTTTTCTCTCTGG + Intergenic
1166103215 19:40583487-40583509 TGAGCAGCAGCCTGTGTCCCGGG + Intronic
1166722533 19:45005153-45005175 AGAGCAAGAGCCTCCGTCTCAGG + Intronic
1166859204 19:45800121-45800143 ACAGCAGCAGAATCCCTCTCTGG - Intronic
1168060276 19:53888071-53888093 AGAACAGCAGCCTCTGTCTGTGG + Intronic
925097691 2:1220377-1220399 GGAGCAGCAGCCCCTCCCTCAGG + Intronic
925262917 2:2543420-2543442 AAAGCAGCAGCCCCCCACTCCGG - Intergenic
925285844 2:2715303-2715325 AGAGGAACAGCCCCTCTCTCAGG + Intergenic
925310263 2:2876760-2876782 AGAGGCGCAGCCTCTCACTCGGG - Intergenic
925355928 2:3241122-3241144 AAAGCAGCAGACTCTTCCTCAGG + Intronic
926210893 2:10868736-10868758 GGAGCAGCATCGTCTCTCTGTGG - Intergenic
927096559 2:19751594-19751616 AGAGCAGCAGCCTCAGACTTGGG - Intergenic
928335177 2:30391879-30391901 TGGGGAACAGCCTCTCTCTCAGG - Intergenic
928442262 2:31302386-31302408 AGAGTAGCAACCTCTCTATGTGG - Intergenic
931857558 2:66319251-66319273 AGAGGGGCAGCCTCCCTTTCAGG + Intergenic
933898382 2:86832092-86832114 AGAGCAGCACACTCTATCTGGGG + Intronic
935127641 2:100238591-100238613 AGAGCGGCAGCCCCTCCCTGGGG + Intergenic
935151423 2:100440068-100440090 AGGGCACCAGCCTTTCCCTCTGG - Intergenic
935677742 2:105610128-105610150 GGACCAGCAGCCTCTCTTGCGGG + Intergenic
936042299 2:109159270-109159292 GGCGCAGCTGCCTCTCTCTCAGG + Intronic
936559975 2:113529010-113529032 AGAGCAGCATCTTCTGTTTCTGG + Intergenic
936779231 2:116012095-116012117 AGAACTGAAGCCACTCTCTCTGG - Intergenic
937758050 2:125564849-125564871 AGAGCAGCAGCTTCTCGCTTGGG + Intergenic
937944409 2:127319262-127319284 CCAGCCTCAGCCTCTCTCTCAGG - Intronic
938186989 2:129240522-129240544 AGAGCTTCAGCCTCCCTTTCTGG - Intergenic
938220013 2:129557836-129557858 AGAGCCACAGACTCTCTCTAAGG + Intergenic
941198036 2:162474466-162474488 AAGGCATCAGCCTTTCTCTCTGG - Intronic
945194698 2:207227315-207227337 AGAGCAGCTGAGACTCTCTCTGG - Intergenic
945724754 2:213462857-213462879 ATAGCAGCACCCACTCTCTGTGG - Intronic
946079783 2:217107605-217107627 ATAGCAGCAGCCTCTTTCTGTGG - Intergenic
946126471 2:217567395-217567417 ATATCAGCATCCTCTGTCTCAGG + Intronic
946131173 2:217608124-217608146 AGGCCAGCAGCTCCTCTCTCAGG + Intronic
946284749 2:218694525-218694547 AGTGCAGCAGCCTGTCTATTGGG + Exonic
947717627 2:232349859-232349881 AGCCCAGCAGCCTTTCACTCTGG + Intergenic
948478696 2:238237502-238237524 AAAGCAGCAGCTTCTCACTGTGG - Intergenic
1169128455 20:3148524-3148546 AGAGCAGCATCCTGTCTTGCTGG - Exonic
1170403838 20:16015414-16015436 AGAGCTGCAGCCTCTGAATCAGG - Intronic
1171326323 20:24296681-24296703 ATTGCAGCAGCCTCTCTTGCTGG - Intergenic
1171774751 20:29354957-29354979 AGAGCAGCTGCCTCTCCCCCAGG - Intergenic
1173384011 20:42571934-42571956 AGAGCACCAGGCTCTAACTCAGG - Intronic
1174050577 20:47764663-47764685 TCACCAGCATCCTCTCTCTCGGG - Intronic
1174413799 20:50353648-50353670 AGCTCCGCAGCCTCTTTCTCTGG - Intergenic
1174674582 20:52341152-52341174 ACAGGAGCAGCCTCTCTCCAGGG + Intergenic
1175418197 20:58815603-58815625 GGAGCAGCAGCGGCTCTCCCAGG - Intergenic
1175688387 20:61047734-61047756 AGAGCAGGAGCCTGACTCACGGG + Intergenic
1175722532 20:61295866-61295888 GAAGCAGCTGCCTCCCTCTCTGG + Intronic
1175786854 20:61717338-61717360 AGAGCAGCAGCGTCTGTGGCTGG - Intronic
1175836556 20:61999627-61999649 AAGGCACCTGCCTCTCTCTCTGG - Intronic
1176844673 21:13867765-13867787 AGAGGATCTGCCTCTGTCTCAGG - Intergenic
1176847414 21:13887329-13887351 AGAGGATCTGCCTCTGTCTCAGG - Intergenic
1180877467 22:19181362-19181384 AGTGCTGCCGCCTCGCTCTCTGG - Intronic
1181015164 22:20064386-20064408 AGAGCAGCAGCCTCAGTCTTGGG - Intronic
1182737863 22:32543850-32543872 TGAGCAGCAGCCTCCATCTTGGG + Intronic
1183194733 22:36345551-36345573 GGAGCTGCAGCCTCACTGTCTGG - Intronic
1184032593 22:41903785-41903807 ACGGCAGCAGCCTCGCTCTGAGG - Intronic
1184690468 22:46115064-46115086 AGAGCAGCCCCCTCTGTCTCCGG + Intergenic
1185069555 22:48648515-48648537 AGTGCAGCCGCCTCCCTCTGTGG - Intronic
1185121768 22:48975559-48975581 AGACCATCCGTCTCTCTCTCTGG + Intergenic
1185389531 22:50551431-50551453 AGAGCTGCAGCCCCTCCCTGTGG - Intronic
950684900 3:14609539-14609561 AGCCCGGCAGCCACTCTCTCTGG - Intergenic
952277383 3:31890533-31890555 AAAGCAGCAGCCTCTCAGGCTGG - Intronic
952421846 3:33139285-33139307 AGAGCAAGACCCTGTCTCTCTGG + Intronic
956157726 3:66316512-66316534 AGATGAGCGGCCTTTCTCTCTGG + Intronic
956207690 3:66771487-66771509 GGAGCTGCTGCCTTTCTCTCAGG + Intergenic
958071237 3:88615766-88615788 AGAGCAGTTTTCTCTCTCTCTGG + Intergenic
961532137 3:127546416-127546438 AGAGGAGCAGCTTGTCTCTCTGG + Intergenic
961624128 3:128247845-128247867 AGAGCAACACCTTCTCTCCCTGG - Intronic
962166588 3:133055634-133055656 AGAGGAGCTGCCTCTTTCTGTGG - Intronic
963921460 3:150909838-150909860 AGTGTAGGAGCCTCTGTCTCTGG - Intronic
967859465 3:194140813-194140835 ACACCAGCAGCCCCTCTCGCCGG + Intergenic
968222916 3:196951680-196951702 AGAGCAGCAGCCTCTCTCTCTGG - Intronic
968757439 4:2424061-2424083 CCAGCAGGAGCCTCTCTCTAAGG - Intronic
969423180 4:7108942-7108964 AGCCCACCAGCCTCTCTCCCTGG + Intergenic
969957594 4:10907735-10907757 TGAGCAACAGCCACTCACTCGGG + Intergenic
973719803 4:53711725-53711747 GGACCAGCAGGCTTTCTCTCAGG - Intronic
974009347 4:56592879-56592901 AGATCTGCAGCATCTCTCTCTGG - Intronic
974620396 4:64346688-64346710 ACAGCAGCAGCTTCTGTCACAGG - Intronic
975626899 4:76359312-76359334 AGAGCAGTATCCTACCTCTCTGG - Intronic
976632949 4:87258121-87258143 AGTGTAGCATCTTCTCTCTCCGG - Intergenic
978102587 4:104860731-104860753 AGAACTGCAGCCTTTTTCTCTGG + Intergenic
978619831 4:110627245-110627267 TGAGCAACAGCCACCCTCTCTGG + Intronic
979321335 4:119328543-119328565 ATAGCTGTACCCTCTCTCTCTGG + Intergenic
981447709 4:144859527-144859549 AGAGAAAAAGCCTCTCTTTCTGG + Intergenic
982176905 4:152714459-152714481 AGGGGACCAACCTCTCTCTCAGG + Intronic
983724807 4:170907775-170907797 AGAGCAGTATCATCTCTCTAGGG + Intergenic
985898673 5:2767437-2767459 ATAGCATCAGCCTCTCTGCCTGG + Intergenic
988064700 5:26219081-26219103 GGAGAAGGAGCCTCTCTCTGTGG - Intergenic
988357705 5:30199432-30199454 AGATCAGCTGCCTCTTTGTCAGG - Intergenic
989212978 5:38875455-38875477 GAAGCAGCAGCCTATCTCTTAGG - Intronic
989443135 5:41495396-41495418 AGTTCAGCAGCCTCTCCCTCAGG + Intronic
989620537 5:43379703-43379725 AGAGCAGGAGCCACTTTATCAGG - Exonic
991971580 5:72146840-72146862 ATAGCATCAGCCTCTTTCTGGGG + Intronic
993294300 5:86114836-86114858 AGAGTGAGAGCCTCTCTCTCTGG + Intergenic
995379760 5:111518687-111518709 CCAGCAGCATCCTCACTCTCTGG - Intergenic
996120411 5:119665597-119665619 AGAGCAGCAGCTGCTCTGTTTGG + Intergenic
996945613 5:129063697-129063719 GGAACAGAACCCTCTCTCTCTGG - Intergenic
997168449 5:131687998-131688020 AGAGAAGCAGCCTTCCTCGCTGG + Intronic
997359073 5:133282857-133282879 AGAGCAGAAGCCCCTTTCCCAGG + Intronic
998530642 5:142881273-142881295 AGCACAGATGCCTCTCTCTCTGG + Intronic
1000117011 5:158162719-158162741 AGAACAGCAACCTCTCTTGCTGG - Intergenic
1000303057 5:159972622-159972644 AAAGCAGCTGCCCCTCTCCCCGG - Intergenic
1001519512 5:172381206-172381228 AGAGCAGCAGCATCTACTTCTGG + Intronic
1002173868 5:177390629-177390651 AGAGCAACACCCGCTATCTCTGG - Intronic
1002309607 5:178306576-178306598 AGAGCAGCCCCCTCTCTCTGAGG - Intronic
1004550726 6:16644674-16644696 AGAGCAGCACGCTGTGTCTCAGG - Intronic
1004583870 6:16980441-16980463 AAAGTAGCAGCCTCTGCCTCTGG + Intergenic
1005485704 6:26297220-26297242 AGACCAGCTGCATCTCACTCAGG - Intergenic
1006843549 6:37047521-37047543 AGAGCTGCAGCCTGGCTCTGAGG + Intergenic
1007181600 6:39933006-39933028 ATAGGAGCAGGCTCTCTCCCTGG + Intronic
1007302769 6:40880517-40880539 AGTGCAGCAGACTCTGTCTTTGG + Intergenic
1007682810 6:43645811-43645833 AGAGCACCACCCTCTCCCTCTGG - Intronic
1011303356 6:85899714-85899736 AGAGGAGCAGCTGCTCTTTCTGG - Intergenic
1011375388 6:86681238-86681260 CCAGCAGCAGCAACTCTCTCGGG - Intergenic
1011650795 6:89504336-89504358 AGAGCAGCAGCTACCCTCTATGG - Intronic
1011745482 6:90403777-90403799 AGAGCAGCAGCGTCTGGGTCTGG + Intergenic
1013851952 6:114526935-114526957 AGAGCAGCTGCCTCTCTGGTGGG - Intergenic
1015862100 6:137691894-137691916 AGAACTACAGCCTCTCTCTATGG + Intergenic
1016131696 6:140481154-140481176 ATAGCTGCTGCTTCTCTCTCAGG + Intergenic
1016353370 6:143192197-143192219 GAAGCAGCAGCCATTCTCTCGGG + Intronic
1016631497 6:146238426-146238448 AGAGGAGCTGCCTCCCTTTCTGG + Intronic
1017584459 6:155904936-155904958 AGAGCAAGACCCTCTCTCTCAGG + Intergenic
1018331171 6:162728325-162728347 GGTGCACCAGCCTCACTCTCTGG + Exonic
1018897572 6:168031134-168031156 AGTGCAGCTGCCATTCTCTCTGG + Intronic
1019210093 6:170397875-170397897 AGAGCCACAGCCTCTCTTTCGGG + Intronic
1019789508 7:3001863-3001885 AGAACAGCAGCCTCACTCCTGGG + Intronic
1020613672 7:10432128-10432150 AGAGCAGCTGCCTCATTCCCTGG + Intergenic
1022001793 7:26233123-26233145 AAAGCAACAGCCTCTTTATCTGG + Intergenic
1022318447 7:29265668-29265690 AGAGAAGAGGGCTCTCTCTCTGG + Intronic
1022323032 7:29304790-29304812 CCAGCTGAAGCCTCTCTCTCTGG - Intronic
1022378140 7:29834666-29834688 AGAGCAGAAGCCACTCTCTTGGG + Exonic
1022945794 7:35282194-35282216 AGAGCACCATCCTGTCTCTGGGG + Intergenic
1023567967 7:41542330-41542352 AGACCACCACCTTCTCTCTCTGG + Intergenic
1024516757 7:50266025-50266047 AGAGCAAGAGCCTCTCCCTCAGG - Intergenic
1025927437 7:65971053-65971075 AGAGGAGCAGCCACTCTTCCAGG + Intronic
1026149153 7:67773363-67773385 TGAGTGCCAGCCTCTCTCTCTGG - Intergenic
1026182065 7:68050233-68050255 AGAGCAAGACCCTCTCTCTAAGG + Intergenic
1026451451 7:70533028-70533050 AAAGCAGAGGCCTCTCACTCAGG + Intronic
1026534676 7:71229889-71229911 AGAGCGGCAGCCTGTGTCTGTGG + Intronic
1029108545 7:98197834-98197856 AGAGCAGGAGCCTCTCAGACAGG - Intronic
1033557165 7:142498983-142499005 ATAGCAACAGCCTCACTCTCAGG - Intergenic
1034228306 7:149499453-149499475 AGAGCAGCTGCATCAGTCTCTGG + Intergenic
1034445945 7:151114561-151114583 AGACTTGCCGCCTCTCTCTCCGG + Intronic
1034449753 7:151130945-151130967 TGAGCAGCCGCTTCTCTCTGGGG + Intronic
1034717475 7:153256778-153256800 AGGGCAGCAGTCTCTCTGCCTGG + Intergenic
1035024025 7:155814991-155815013 AGAGCAGCAGCTTCTCTGGGGGG - Intergenic
1035446896 7:158949334-158949356 AAAGCAGCATCTTCTCTCCCAGG - Intronic
1035618363 8:1019278-1019300 AGCTCAGAAGCCTCTCTCTGTGG + Intergenic
1035733387 8:1869286-1869308 AGCTCAGCAGCCTTTCCCTCTGG + Intronic
1036030721 8:4968872-4968894 AAAGCATCAGTCTGTCTCTCGGG + Intronic
1036945432 8:13090404-13090426 AGAGCTGAAGCCCCTCACTCTGG - Exonic
1037943749 8:22973854-22973876 AGAGCAGCAGCCTGCCCCACCGG + Intronic
1040028223 8:42801096-42801118 AGAGCGGCAGCCCTGCTCTCCGG - Intergenic
1040059799 8:43094058-43094080 ATAGAAACAGCCTCTCACTCTGG - Intronic
1041263063 8:56038379-56038401 AGAGAAGCAGCCTCACTCAGTGG - Intergenic
1042387443 8:68193822-68193844 AAGGCAGCAGCCTCTCCATCTGG + Intronic
1042437993 8:68790228-68790250 AGATCATCTGCCTCTGTCTCAGG + Intronic
1042948278 8:74176194-74176216 ATACCAGCACCCTTTCTCTCAGG + Intergenic
1044626111 8:94235873-94235895 AGAGCAGGAGCCTGTCCCTTTGG - Intergenic
1046538976 8:115554789-115554811 AGAGCAGCTGCCCTTATCTCAGG - Intronic
1047460692 8:125061868-125061890 TGAGCATCAGCCTCTTTATCTGG - Intronic
1049785470 8:144448661-144448683 GGAGCAGCTGCCTCTGACTCTGG - Intergenic
1049892890 9:87354-87376 AGAGCAGCATCTTCTGTTTCTGG - Intergenic
1050537736 9:6645256-6645278 AGGTCTGCAGCATCTCTCTCTGG + Exonic
1050690963 9:8225446-8225468 AAAGCAGCATCTTTTCTCTCAGG - Intergenic
1053265673 9:36711409-36711431 AGAGCACCAGCCTCCCTTGCAGG - Intergenic
1055798618 9:80005218-80005240 AGAAGAGCAGCCACACTCTCTGG + Intergenic
1056923893 9:90815899-90815921 AGAGCAACTGCTTCTCTATCTGG + Intronic
1057137030 9:92698819-92698841 AGACCTGCAGCCTTTTTCTCTGG + Intergenic
1057721546 9:97535710-97535732 ATAGCAGCACAGTCTCTCTCTGG - Intronic
1060779506 9:126401068-126401090 TGGGCAGCAGCTTCTCCCTCAGG - Intronic
1060933235 9:127502031-127502053 GGAGCAGCAGCCACTGACTCAGG - Intronic
1061547063 9:131310633-131310655 AGAGCTTCAGCATCTCTTTCTGG + Intergenic
1062046929 9:134428630-134428652 AGAGCCGCAGCCTCTTTCGGGGG - Intronic
1062204925 9:135330691-135330713 AGAGCAGCCGTCTGTCCCTCTGG - Intergenic
1062416870 9:136455604-136455626 AGGGCAGCAGCCGCACGCTCGGG + Exonic
1203780653 EBV:98928-98950 AGAGCAGCAGCTACACTCTGGGG + Intergenic
1186428888 X:9487547-9487569 GGAGGAGCAGCCTGTGTCTCTGG - Intronic
1187621692 X:21063044-21063066 AAGGCAGCATCCTGTCTCTCAGG - Intergenic
1188090492 X:25958683-25958705 AGAGCAGGACCCTGTCTCTGGGG - Intergenic
1189234487 X:39476943-39476965 AGAGCAGCAGCCTTTAGCTCTGG + Intergenic
1190151902 X:47956298-47956320 AGAGCTGCAGCCTCCCACACTGG - Intronic
1192223951 X:69215835-69215857 AGAGCAGCTGCCCCACTCTGGGG + Intergenic
1196537756 X:116867849-116867871 ACATCAGCTGCCTCTCCCTCTGG + Intergenic
1199656428 X:149999574-149999596 GCACCAGCAGCCTCTCTCTGAGG - Intergenic
1199783128 X:151081727-151081749 GGAGCAGCAGCCTCTCCTTAGGG - Intergenic
1202152050 Y:21852333-21852355 AGGGCAGGAATCTCTCTCTCAGG - Intergenic
1202152734 Y:21857826-21857848 GGAGCAGGAATCTCTCTCTCAGG - Intergenic