ID: 968224705

View in Genome Browser
Species Human (GRCh38)
Location 3:196966544-196966566
Sequence CAGCCTGGGTGGGCCCACTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 356
Summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 324}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968224697_968224705 -6 Left 968224697 3:196966527-196966549 CCTTTGAGATTCATCTCCAGCCT 0: 1
1: 0
2: 1
3: 21
4: 201
Right 968224705 3:196966544-196966566 CAGCCTGGGTGGGCCCACTGGGG 0: 1
1: 0
2: 1
3: 30
4: 324
968224694_968224705 9 Left 968224694 3:196966512-196966534 CCCAGGCATGGAGTCCCTTTGAG 0: 1
1: 0
2: 2
3: 11
4: 205
Right 968224705 3:196966544-196966566 CAGCCTGGGTGGGCCCACTGGGG 0: 1
1: 0
2: 1
3: 30
4: 324
968224695_968224705 8 Left 968224695 3:196966513-196966535 CCAGGCATGGAGTCCCTTTGAGA 0: 1
1: 0
2: 3
3: 16
4: 138
Right 968224705 3:196966544-196966566 CAGCCTGGGTGGGCCCACTGGGG 0: 1
1: 0
2: 1
3: 30
4: 324
968224691_968224705 27 Left 968224691 3:196966494-196966516 CCTGCTTGGCTGAGGTCTCCCAG 0: 1
1: 0
2: 1
3: 16
4: 221
Right 968224705 3:196966544-196966566 CAGCCTGGGTGGGCCCACTGGGG 0: 1
1: 0
2: 1
3: 30
4: 324
968224696_968224705 -5 Left 968224696 3:196966526-196966548 CCCTTTGAGATTCATCTCCAGCC 0: 1
1: 0
2: 1
3: 18
4: 185
Right 968224705 3:196966544-196966566 CAGCCTGGGTGGGCCCACTGGGG 0: 1
1: 0
2: 1
3: 30
4: 324
968224690_968224705 28 Left 968224690 3:196966493-196966515 CCCTGCTTGGCTGAGGTCTCCCA 0: 1
1: 0
2: 2
3: 21
4: 207
Right 968224705 3:196966544-196966566 CAGCCTGGGTGGGCCCACTGGGG 0: 1
1: 0
2: 1
3: 30
4: 324

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968224705 Original CRISPR CAGCCTGGGTGGGCCCACTG GGG Intronic
900290407 1:1921306-1921328 CAGGCTGGGTGGGCTCTGTGGGG + Intergenic
900404735 1:2487536-2487558 CAGCCTGCCTGGGCTCACTGTGG + Intronic
900682870 1:3926490-3926512 TTGTCTGGGTGGGCCCAATGTGG - Intergenic
900711834 1:4119353-4119375 CCCACTGGGAGGGCCCACTGGGG + Intergenic
901391510 1:8949211-8949233 CTGCCTGGCTGCGCCCACTCTGG - Intronic
903268029 1:22170169-22170191 CTGCCTGAGAGGGCCCACGGAGG + Intergenic
903332303 1:22602382-22602404 CTGCCTGGGTGAGCCCACCCCGG + Exonic
903332304 1:22602385-22602407 CAGCCGGGGTGGGCTCACCCAGG - Exonic
904494462 1:30878786-30878808 CAGCCTGGGTGAGCCCAGAAGGG + Intronic
905521720 1:38605531-38605553 CAGCCTTGCTGGGCACACAGTGG - Intergenic
906033121 1:42735778-42735800 CACCCTGGGCAGGGCCACTGGGG - Intronic
907554719 1:55334154-55334176 AAGCCAGGGTGGCCCCATTGAGG - Intergenic
912624191 1:111194297-111194319 CAGCCTGGGTGGGACCAGTTAGG - Intronic
913960487 1:143334980-143335002 CAGCGTGGGGGGGCCCACCTTGG + Intergenic
914054842 1:144160552-144160574 CAGCGTGGGGGGGCCCACCTTGG + Intergenic
914124304 1:144805809-144805831 CAGCGTGGGGGGGCCCACCTTGG - Intergenic
915066732 1:153231228-153231250 CAGCCTGAGTGGGGACACAGAGG + Intergenic
915251012 1:154588506-154588528 CAGCCTGGCAGGGCCCACCCTGG + Intronic
915634113 1:157174418-157174440 AAGCCTCGGTGGTCTCACTGGGG - Intergenic
916445404 1:164867520-164867542 CAGACTGGATAGGCCCACTCTGG - Intronic
919733579 1:200930066-200930088 GGGCCTGGGTGGGGCCACAGAGG + Intergenic
920110144 1:203581972-203581994 CAGCCTTTGTGGGCTCATTGGGG - Intergenic
922703942 1:227779098-227779120 CACCCTGGCTGGGCCCATTCCGG + Intronic
924019415 1:239765168-239765190 AAGACTGGGTGGCCCAACTGTGG - Intronic
1067097193 10:43309528-43309550 CAGCCTGGGCATGCCCACAGGGG + Intergenic
1067164287 10:43852847-43852869 CAGCCTGGATGGGTCCAGTCAGG + Intergenic
1067750725 10:48969508-48969530 CAGTGTGGGTGGGCTCAATGTGG - Intronic
1067803961 10:49380585-49380607 CAGGCTTGCTGGGCTCACTGTGG - Intronic
1069901468 10:71708918-71708940 CAGCTTGGGTGGGCTCAGCGGGG - Intronic
1070334411 10:75441371-75441393 CAGCCTGCCTGGCCCCACTCTGG + Intronic
1070775776 10:79108930-79108952 GGGCCTGGGTGTGCCCACTCAGG - Intronic
1071436698 10:85654163-85654185 CAGCCTCGGAGGGCCAGCTGAGG + Intronic
1072618202 10:97063488-97063510 CAGCCTGCGTGGCCTCAATGTGG - Exonic
1072656436 10:97333759-97333781 CAGCCTGGGAGCGACCACTTTGG - Exonic
1073113379 10:101076214-101076236 CAGCCTAGGTGGCCCCACCCTGG - Intergenic
1073729195 10:106270039-106270061 CCTCCTGGGTGGACCCAGTGAGG - Intergenic
1074483536 10:113851752-113851774 CAGCCTGGGTGGGGCGACAGAGG - Intronic
1075092350 10:119450913-119450935 CAGCCTGGGGAGGGCCAGTGGGG - Intronic
1075398188 10:122142757-122142779 CAGCCTGGCCAGTCCCACTGTGG + Intronic
1075688215 10:124378491-124378513 GAGCCTGGGTGGGCCAAGAGGGG - Intergenic
1075969881 10:126643391-126643413 CAGCTTGGGAGGGGCCACAGAGG - Intronic
1076589124 10:131571014-131571036 CAGCCTGCGTGGGACCAGTTGGG - Intergenic
1076594816 10:131618972-131618994 CAGCCTGGGAGGGGCCCGTGGGG + Intergenic
1076697935 10:132256054-132256076 CAGCCTCGGGGAGCCAACTGGGG + Intronic
1076723460 10:132402797-132402819 CGGCTTGGGTGGCCCCACTGTGG + Intronic
1076876572 10:133219209-133219231 CAGCCAGGGTGGCCTCACGGAGG + Intronic
1077110617 11:860535-860557 CACCCTGGCAGGGCCCACGGAGG - Intronic
1077115838 11:884314-884336 CAGCTTGGTTGGGGCCACAGAGG + Intronic
1077212989 11:1382145-1382167 AAGCCTGGAGGGGCACACTGAGG - Intergenic
1077341858 11:2029779-2029801 CAGCCTGGATGGGGGCATTGGGG + Intergenic
1078156437 11:8803973-8803995 CAGCCTAGGTGGAGCCCCTGAGG - Intronic
1078240787 11:9529456-9529478 CAGCCTGGCTGGGCCCAGTGGGG - Intergenic
1078564702 11:12404433-12404455 CAGTCTGGGTGGGCCCAGGAGGG + Intronic
1078740180 11:14059167-14059189 CAGCCTGGGCTGGACCAGTGAGG + Intronic
1079135545 11:17774326-17774348 CAGCCTGAGTGGCATCACTGTGG + Intronic
1079305337 11:19316757-19316779 CAGCCAGGGCTGGCCCTCTGTGG + Intergenic
1081601029 11:44494376-44494398 CAGATTGGGTGGGCCCAGTATGG + Intergenic
1082000467 11:47391265-47391287 CAGCCTGGGTGGGGCTGGTGAGG + Intergenic
1082868076 11:57917991-57918013 CAGCCTGGGGATGTCCACTGTGG + Intergenic
1083481286 11:62949251-62949273 CAGCCTGGGTTGGCAGAGTGTGG + Intronic
1083719935 11:64599080-64599102 CAGGCCGGGTGGGCTCACTGAGG + Intronic
1083905022 11:65663499-65663521 CAGCCCGGATGGGACGACTGAGG + Intergenic
1084092245 11:66886282-66886304 CAGCCTGGCGTGGCCCGCTGAGG + Intronic
1084124974 11:67093494-67093516 CTGGCTGGGTGGGCCACCTGAGG + Intergenic
1084265733 11:68004225-68004247 CTGCCTGTGTGTGCCCTCTGGGG + Intronic
1084556406 11:69878767-69878789 CAGGCTGAGGGGGCCCAATGGGG - Intergenic
1087016877 11:93562539-93562561 CAGCCTGGCCTAGCCCACTGTGG - Intergenic
1089784895 11:120900898-120900920 CAGCCTGGCTGAGTCCACTTTGG + Intronic
1091106125 11:132921362-132921384 TGGCCTGGAAGGGCCCACTGTGG - Intronic
1202824844 11_KI270721v1_random:84968-84990 CAGCCTGGATGGGGGCATTGGGG + Intergenic
1091705169 12:2688707-2688729 CAGCCTGGCTGGGCACCATGAGG - Exonic
1091727270 12:2854859-2854881 CAGGCTGGGTGGGCTCCCTGAGG + Intronic
1097870372 12:64596959-64596981 CAGCCTGGGTGGATCACCTGAGG - Intergenic
1098285402 12:68901956-68901978 CAGCCTGGGAATGCCAACTGAGG + Intronic
1101402274 12:104398865-104398887 CAGCCTGGGTGGATCATCTGAGG - Intergenic
1101656301 12:106723519-106723541 CAGCCTGGGTGTGACAGCTGAGG + Intronic
1102508564 12:113399135-113399157 CAGCCTTGCTTGGCCCACTGTGG + Exonic
1104769911 12:131354931-131354953 CAGCCTGGGAGGCCCCTCGGGGG - Intergenic
1104997650 12:132668601-132668623 CCGCCTGGGTGGGCACTCGGTGG - Intronic
1105293710 13:19070997-19071019 CAGGCTGGCTGGGCCCTCTCTGG + Intergenic
1107479724 13:40776018-40776040 GAGGCTGGATGGGCTCACTGGGG + Intergenic
1108323770 13:49310192-49310214 AGGCATGGGTGCGCCCACTGAGG + Exonic
1109991321 13:70061069-70061091 CAGGCTGGGAGGGGTCACTGGGG + Intronic
1116786832 14:49297196-49297218 CAGGCTGGCTGAGCCCACTCTGG + Intergenic
1118839484 14:69500233-69500255 CAGCAGGGGAGGGCCCAGTGCGG + Intronic
1119438204 14:74611641-74611663 CCGCCTCGGTGGGCCTCCTGGGG + Exonic
1122149795 14:99718711-99718733 CAGGCTGGGTGGGAGCTCTGGGG + Intronic
1122402523 14:101475688-101475710 GGGCCTGGGGGGCCCCACTGGGG - Intergenic
1122778085 14:104131622-104131644 GAGCCAGGGTGGGGCCAGTGAGG + Intergenic
1125548452 15:40526071-40526093 GTGCCTGTGTGGGCCCACTGCGG + Intergenic
1125750535 15:42024585-42024607 CATCCTTGCTGGGCCCACAGGGG - Intronic
1126233352 15:46353807-46353829 CAGCCTGGGAGGCCCCACCCAGG - Intergenic
1127922347 15:63503947-63503969 CTGCGTGGGTGGGCCCGCAGGGG - Intergenic
1128730244 15:70015828-70015850 CAGGCTGGAGGGGCCCCCTGGGG - Intergenic
1128940211 15:71781945-71781967 CAGCCATGGGGAGCCCACTGTGG + Exonic
1129231399 15:74199060-74199082 CAGCATGGGTGAGGCCAGTGGGG + Intronic
1130715569 15:86330102-86330124 CAGCCTGGCCCTGCCCACTGTGG + Intronic
1130987140 15:88852007-88852029 CAGCGGGGATGTGCCCACTGGGG - Exonic
1132469167 16:92345-92367 CAGCCAGGGTGGGCTCTATGGGG + Intronic
1132606747 16:796857-796879 GAGCCTGGGTGGGCTCACCTGGG - Exonic
1132645413 16:997233-997255 CTGCCTGGGTGTGTCCAGTGGGG - Intergenic
1132657595 16:1047898-1047920 CTGCCTGAGTGGCCCCACAGTGG - Intergenic
1134064932 16:11221985-11222007 CAGTCTGGGTGGTGCCTCTGTGG + Intergenic
1135500872 16:22994790-22994812 CAGCCTGGGAGTGAGCACTGGGG - Intergenic
1135565219 16:23506686-23506708 CCGTCCGGGTGGGCCCACTTCGG + Intronic
1136024846 16:27462727-27462749 CAATGTGGGTGGGCCCACTGAGG - Intronic
1138530350 16:57631287-57631309 CAGCCATGGAGGGACCACTGCGG + Intronic
1139430780 16:66910126-66910148 CAGCCTGGACAGGCCCTCTGGGG + Intronic
1139602192 16:67993539-67993561 CCACCTGGGTCGGCCCCCTGGGG - Exonic
1139670746 16:68491239-68491261 CAGCCTGGATGGGCTCCCGGAGG + Intergenic
1139853060 16:69962157-69962179 CTGCCTGGCTGGGCCCTTTGAGG + Intronic
1139882031 16:70185065-70185087 CTGCCTGGCTGGGCCCTTTGAGG + Intronic
1140370478 16:74410440-74410462 CTGCCTGGCTGGGCCCTTTGAGG - Intronic
1141461034 16:84179059-84179081 CAGCCTGGGGTGTCCCTCTGGGG + Exonic
1141577933 16:84976678-84976700 CAGCCGGGCTGGGCTCACAGAGG - Intronic
1141674795 16:85512134-85512156 CAGCCTGGCTGGGCCCACCATGG + Intergenic
1142033972 16:87852396-87852418 CAGCCTGGGAGGGGCCACAGGGG + Intronic
1142145866 16:88492734-88492756 CAGCCTGGCTGGACCCATGGTGG - Intronic
1142377082 16:89711798-89711820 CCGCCTGGGTGGGCCCCCGTGGG - Intronic
1142680671 17:1546394-1546416 GAACCTGTGTGGGGCCACTGAGG + Intronic
1143204379 17:5132166-5132188 CAGCCTGGCTGGGGTTACTGGGG - Intronic
1143408853 17:6696527-6696549 CATCCTGGATGGGCCCCCTTGGG + Intronic
1143890037 17:10095966-10095988 CAACCTGGCTGTGCCCATTGCGG + Intronic
1144684125 17:17215074-17215096 CAGGATGGTGGGGCCCACTGGGG + Exonic
1144872644 17:18380532-18380554 CAGCCTGGCTGGGCCCTGGGAGG - Intronic
1144875451 17:18394857-18394879 CAGCCTGGCTGGGGTTACTGGGG - Intergenic
1145156774 17:20549564-20549586 CAGCCTGGCTGGGGTTACTGGGG + Intergenic
1145318222 17:21747671-21747693 CAGCCAGGGCTAGCCCACTGGGG + Intergenic
1145747514 17:27331488-27331510 CATTATGGGTGGGCACACTGAGG - Intergenic
1145795178 17:27651310-27651332 CTGCCTGGGTTGTCCCTCTGTGG + Intergenic
1145796150 17:27656425-27656447 AAGCCCGGGAGGGCCCACTGAGG - Intergenic
1145810601 17:27761748-27761770 AAGCCCAGGAGGGCCCACTGAGG - Intronic
1146004743 17:29154280-29154302 CACCCTGTGCGGGCACACTGAGG - Intronic
1146833215 17:36088624-36088646 CGACCTCGGTGGGCCCAGTGGGG - Exonic
1146883780 17:36457737-36457759 CAGCCTGGCTGGGGTTACTGGGG + Intergenic
1147660349 17:42113901-42113923 CCACCAGGGTGGGCCCCCTGGGG + Intronic
1148082600 17:44975948-44975970 CAGCCTAGTTCAGCCCACTGAGG - Intergenic
1148214199 17:45825504-45825526 CAGCCTGGGAGAGCACACCGTGG + Intronic
1148557166 17:48585497-48585519 CAGCCAGGCTGGGGCCTCTGAGG - Intronic
1149627218 17:58088391-58088413 CAGCGTTGGTGGGCCCATGGTGG + Intronic
1149943758 17:60899185-60899207 CAGCCTAGCTGTGGCCACTGAGG - Intronic
1151748612 17:76024490-76024512 CAGCCTGGCTGGGCCCTGGGAGG + Intronic
1152309900 17:79543829-79543851 CAGCCAGGGTGGGCCGAATGGGG + Intergenic
1152318823 17:79596523-79596545 TGGCCTGGCTGGGCCCACGGTGG - Intergenic
1152362153 17:79837694-79837716 CGGCCTGGATGGGCACGCTGCGG - Intronic
1152633111 17:81419541-81419563 CCGCCTGGGCGGGCCCTGTGGGG + Intronic
1154209399 18:12366547-12366569 CAGCCTCTTTGGGCCCTCTGTGG - Intronic
1158306038 18:56106597-56106619 CAGACTGGGTTGGTCAACTGAGG - Intergenic
1159885434 18:73899147-73899169 CAGGCTGGGTGGACCCACCTGGG - Intergenic
1161138175 19:2633020-2633042 CAGCCTGGGGAGGCCCAAGGTGG - Intronic
1161216479 19:3097275-3097297 CAGCTTGGCTGGGCCTCCTGCGG - Intronic
1161338924 19:3730171-3730193 CAGCCTGGGTCGTGCCGCTGTGG + Intronic
1161994475 19:7703869-7703891 AAGCCAGGGTGGGGTCACTGGGG - Intergenic
1162743069 19:12783998-12784020 CAGCGTGGGGGGGCCCTCTCAGG - Intronic
1163055582 19:14715298-14715320 CAGCCAGGGTGGGCAGACTTGGG + Intronic
1163161144 19:15464614-15464636 CAGGCTGGGAGGGCACAGTGCGG + Intergenic
1163612577 19:18309004-18309026 CAGGGTGGGTGGGGCCTCTGGGG - Intronic
1163647139 19:18495848-18495870 CAGCCAGGGCAGGCCCACTGAGG + Intronic
1163666445 19:18606117-18606139 CCGCCTGGGGGGGCCCGCTGGGG + Intronic
1165012916 19:32861879-32861901 GAGCCTGTGTTGGCCCAGTGAGG + Intronic
1165057495 19:33187293-33187315 CAGGCTGGATGGGTGCACTGTGG + Intronic
1165247360 19:34505147-34505169 CAGCCTGGGTGGGGGCTCAGAGG + Exonic
1165433472 19:35784842-35784864 CAGCCCGGGTGGGCATGCTGCGG + Intronic
1165777750 19:38414820-38414842 CAGCCTGGGCGGGGCCAGGGGGG + Intronic
1165931628 19:39362851-39362873 CAGTCTGGGTGGGGAAACTGAGG + Intronic
1166105336 19:40595405-40595427 GAGCCTGGCTGGGTTCACTGAGG - Intronic
1166105555 19:40596541-40596563 GAGCCTGGCTGGGTTCACTGAGG + Intronic
1166268025 19:41696910-41696932 CTGCCTGGGTGGGGACACTGGGG - Intronic
1167350116 19:48969158-48969180 CGGACTGGGTGGGGGCACTGCGG + Exonic
1168692456 19:58385399-58385421 CAGCCTTGGGGCTCCCACTGGGG - Intergenic
1202694323 1_KI270712v1_random:113231-113253 CAGCGTGGGGGGGCCCACCTTGG + Intergenic
926125675 2:10270342-10270364 CAGCCTGGGTGAGGCCCCAGGGG - Intergenic
927847957 2:26480978-26481000 CACCCAGGCTGGGCCCAGTGTGG + Exonic
927872205 2:26630815-26630837 CAGGCTGGGTGTCCCCTCTGAGG - Intronic
929459465 2:42091625-42091647 CAGCCAGGATGGGCCCTCAGTGG + Intergenic
931430995 2:62208943-62208965 CAACCTGGGTGGGGGCAGTGGGG + Intronic
931697036 2:64879098-64879120 CAGCCTGAGTGAGCCAGCTGAGG - Intergenic
933952238 2:87341337-87341359 CAGCGTGGGGGGGCCCACCTTGG - Intergenic
933971660 2:87474537-87474559 CAGCCAAGGTGAGCTCACTGAGG + Intergenic
934887336 2:98036553-98036575 CTGCCTGTGTGGGGCCCCTGAGG - Intergenic
935170611 2:100608742-100608764 GAGCCTGGCTGGGCCACCTGTGG - Intergenic
935216258 2:100977468-100977490 CAGCCTGGCAGAGCACACTGTGG + Intronic
935809235 2:106780500-106780522 CAGCCTGGGAGTACACACTGCGG + Intergenic
936151841 2:110025999-110026021 CAGGCTGGCAGGGCCCGCTGGGG + Intergenic
936192833 2:110345370-110345392 CAGGCTGGCAGGGCCCGCTGGGG - Intergenic
936322069 2:111475662-111475684 CAGCCAAGGTGAGCTCACTGAGG - Intergenic
938243964 2:129763348-129763370 CAGGCTGGGTGGGCCCGCATTGG + Intergenic
939545776 2:143551178-143551200 CAGCCTGGGTGGACAGAGTGAGG - Intronic
939782538 2:146465933-146465955 CAGCCTGTCTGGGCTCAGTGCGG - Intergenic
942325751 2:174775896-174775918 CAGCATGGGCGGGGCCATTGAGG + Intergenic
946157752 2:217818188-217818210 CAGCCTGGGCCGGCACCCTGGGG - Exonic
948619755 2:239227088-239227110 CAGCCAGGGTGGGCCAAGGGAGG + Intronic
948724099 2:239921200-239921222 CAGCAGGGTTGGGCCCAATGAGG - Intronic
948817376 2:240519409-240519431 CAGCAAGCGTGGGCTCACTGCGG - Intronic
948890100 2:240903355-240903377 GAGCCTGGCTGGGCCCCCCGGGG - Intergenic
949064519 2:241981603-241981625 CAGTCTGGGTGGCCCCTTTGTGG - Intergenic
1169754263 20:9026403-9026425 CAGGCAAGGTGAGCCCACTGGGG + Intergenic
1171105719 20:22430602-22430624 CAGCAGAGGTGGCCCCACTGAGG - Intergenic
1172873507 20:38150190-38150212 CAGCCCAGGCTGGCCCACTGGGG + Intronic
1174072461 20:47908742-47908764 CAGACTGCGGGGGCCCACAGAGG + Intergenic
1175248910 20:57597251-57597273 GAGCCCGGGTGGGGCCGCTGGGG + Intergenic
1175466475 20:59193548-59193570 CAGGCTGCGTGGGCCCACCTGGG - Exonic
1175957540 20:62618961-62618983 CATCCTGTGTGGGCTGACTGTGG + Intergenic
1179279301 21:39920868-39920890 CATCCTGGTTGGCCTCACTGTGG + Intronic
1179788339 21:43741817-43741839 CAGCCAGGGTGGGCTCAGGGAGG + Intronic
1179823601 21:43951607-43951629 CAGCTGGGGTGGGCACTCTGTGG + Intronic
1179920091 21:44503181-44503203 CGGCCTTGGTGAGCCCACAGGGG + Intronic
1179920108 21:44503228-44503250 CGGCCTTGGTGAGCCCACGGGGG + Intronic
1179920204 21:44503532-44503554 CGGCCTTGGTGAGCCCACAGTGG + Intronic
1179920241 21:44503653-44503675 CGGCCTTGGTGAGCCCACAGCGG + Intronic
1179920310 21:44503866-44503888 CGGCCTTGGTGAGCCCACAGGGG + Intronic
1179920392 21:44504174-44504196 CGGCCTTGGTGAGCCCACAGTGG + Intronic
1179920478 21:44504478-44504500 CGGCCTCGGTGAGCCCACAGTGG + Intronic
1179920492 21:44504525-44504547 CGGCCTCGGTGAGCCCACAGTGG + Intronic
1179920504 21:44504572-44504594 CGGCCTCGGTGAGCCCACAGTGG + Intronic
1179920516 21:44504619-44504641 CGGCCTCGGTGAGCCCACAGTGG + Intronic
1179920528 21:44504666-44504688 CGGCCTCGGTGAGCCCACAGTGG + Intronic
1179920540 21:44504713-44504735 CGGCCTCGGTGAGCCCACAGTGG + Intronic
1179967939 21:44817788-44817810 CACCTTGGGCGGGCCCACTTAGG + Intronic
1180088843 21:45523740-45523762 CAGCCTGGCTGGGGCCACACAGG + Intronic
1182073159 22:27477349-27477371 CAGCAGGGGTGGGACCACAGGGG - Intergenic
1182356233 22:29723382-29723404 CAGCCATGGTGGGCACACAGAGG - Intronic
1183299799 22:37053244-37053266 CAGCCTGCCAGGGCCCTCTGTGG + Intronic
1183510067 22:38229548-38229570 TAGCCTGGGTGGGGGCAGTGTGG - Intronic
1183746332 22:39694123-39694145 CAGCCTGGAGGGGCAGACTGAGG + Intergenic
1184049118 22:41991251-41991273 CAGCACAGGTGAGCCCACTGGGG - Intronic
1184333570 22:43840608-43840630 CAGCCTGGCAGCACCCACTGGGG - Intronic
1184473092 22:44707010-44707032 CAGCCTGGGAGAGCCCGATGGGG - Intronic
1184861258 22:47174410-47174432 CAGCCTGGGTGGGCCTCCAGGGG - Exonic
1185228504 22:49667518-49667540 CAGGCTGGCTGGGCCCATTCCGG - Intergenic
1185287824 22:50010428-50010450 CAGCGTGGGGAGGCCCAGTGAGG + Intronic
950263118 3:11556019-11556041 CAGGCTGGGTGGGCGGACTCGGG - Exonic
950475138 3:13210237-13210259 CAGGCTGGGGGGACCCAGTGAGG + Intergenic
954410621 3:50369154-50369176 CACCCTGGGTGTGTCCAATGTGG - Intronic
955750107 3:62178391-62178413 CAGGCTGGGTGCTCCTACTGGGG + Intronic
957052484 3:75421102-75421124 CAGCCAGGGTGGGACCATGGGGG + Intergenic
958547082 3:95567525-95567547 CTGCCTGAGTTGGGCCACTGGGG + Intergenic
958825404 3:99024031-99024053 CAGCCTGGTTAGGCCCTCTGTGG + Intergenic
961093819 3:124138036-124138058 CAGCCTGCTGGGGGCCACTGGGG - Intronic
961788324 3:129360620-129360642 CAGGCTGGGGGGACCCAGTGAGG - Intergenic
962473315 3:135732510-135732532 CAGCCTGTCTGGGCTCAGTGTGG - Intergenic
968067239 3:195765344-195765366 CAGCCTCGGTGGCCCAGCTGGGG - Exonic
968138355 3:196235706-196235728 CAACATGGGTGGGCCAAATGTGG - Exonic
968224705 3:196966544-196966566 CAGCCTGGGTGGGCCCACTGGGG + Intronic
968262398 3:197335665-197335687 AAGCCTCTGAGGGCCCACTGGGG + Intergenic
968747312 4:2366785-2366807 GAGGCTGGGTTGGCCCCCTGAGG + Intronic
968910252 4:3473786-3473808 CAGCCTGGGGGTGCCCACGAGGG + Intronic
969264128 4:6054175-6054197 CAGGATGGGTGGGAGCACTGGGG + Intronic
969411563 4:7031792-7031814 CAGCCTGGGGGCACCCCCTGGGG - Exonic
969442231 4:7224211-7224233 CAGCCTGGCTCAGCCCCCTGGGG - Intronic
969523275 4:7691272-7691294 CAGCCTTGGAGGGCCCACCCTGG - Intronic
969524281 4:7696218-7696240 CACCCAGGGTGGGGCCTCTGGGG + Intronic
971372416 4:26029298-26029320 CAGCCTGGGGAGGGCCCCTGCGG - Intergenic
978039055 4:104036054-104036076 CAGCATGGGTTGCTCCACTGTGG + Intergenic
982063217 4:151625201-151625223 CACTCTGGTTGGACCCACTGGGG + Intronic
985303607 4:188515073-188515095 CGGCCTTGGTGGGCCCACAGTGG - Intergenic
985689580 5:1299665-1299687 CAGCCTGGGGTGCCACACTGAGG - Intergenic
985712078 5:1435219-1435241 CTGCCTGGGTGAGTTCACTGTGG - Intronic
985956492 5:3269611-3269633 CAGGCTGGCTGGGCCCACGGAGG + Intergenic
986462204 5:7983657-7983679 CAGCCTGGGTGGAGCCCCCGAGG + Intergenic
987218998 5:15770245-15770267 CACCCAGGCTGGGCACACTGGGG - Intronic
989584074 5:43060892-43060914 CAGCATGAGTGCTCCCACTGAGG - Intergenic
992056534 5:72996680-72996702 CAGCCTGCGGGGGCCCACATGGG - Intronic
994006140 5:94839612-94839634 CAGCCTGAGAGGGACCACTGTGG - Intronic
997206420 5:132052803-132052825 GGGTCTGGGTGGGCCCACTCAGG + Intergenic
997616162 5:135247577-135247599 CACCTGGGTTGGGCCCACTGGGG + Intronic
997720598 5:136075590-136075612 CAACCTGACTGGGCCCCCTGGGG - Intergenic
998104123 5:139457495-139457517 CATCCAGGGAGGGCCCAGTGAGG - Intronic
998340148 5:141410053-141410075 CAGCCTGGGGCTGCGCACTGGGG + Exonic
1001775671 5:174327567-174327589 CAGCCTGGCTGGGGGCACTGCGG + Intergenic
1001980286 5:176033563-176033585 CATCCTGGCTGGGCCTCCTGTGG - Intronic
1001980299 5:176033630-176033652 CATCCTGGCTGGGCCTCCTGTGG - Intronic
1001980312 5:176033697-176033719 CATCCTGGCTGGGCCTCCTGTGG - Intronic
1001980325 5:176033764-176033786 CATCCTGGCTGGGCCTCCTGTGG - Intronic
1001980338 5:176033831-176033853 CATCCTGGCTGGGCCTCCTGTGG - Intronic
1001980351 5:176033898-176033920 CATCCTGGCTGGGCCTCCTGTGG - Intronic
1002634071 5:180598528-180598550 CAGCCTGGGCTGCCCCTCTGTGG - Intergenic
1002641121 5:180631064-180631086 CACCCTGGGAGCACCCACTGGGG - Intronic
1002897481 6:1388133-1388155 CAGCCTAGGCAGGCCCCCTGGGG - Intergenic
1003175642 6:3751058-3751080 CAGCCTGGGGGCGCCCCCGGCGG - Intronic
1003567192 6:7231215-7231237 CAGCCTTGCTGCGTCCACTGCGG + Exonic
1003957032 6:11173667-11173689 CAGCCTGGGAGGGGGCATTGAGG - Intergenic
1004346958 6:14857541-14857563 TGGGCTGGGTGAGCCCACTGAGG - Intergenic
1005997187 6:30938635-30938657 CAGCCTGAGGGGGCTCCCTGTGG - Intergenic
1006449994 6:34100152-34100174 CAGCCTGCGAGGGCCCACCTTGG + Intronic
1007264156 6:40584912-40584934 CAGAGTGGGTGGGGCCACCGGGG - Intronic
1007363368 6:41373709-41373731 CACCCTCTGTGGGCCCACGGTGG - Intergenic
1007752870 6:44080877-44080899 CATCCTGAGAGGGCCCACTGGGG + Intergenic
1013604069 6:111731841-111731863 CACCCTGGGTGAGCCCAGGGTGG + Intronic
1014592590 6:123292238-123292260 CAGCCATGGGGGTCCCACTGAGG - Intronic
1017148999 6:151261153-151261175 CAGCGTGGGTGGGTCACCTGAGG + Intronic
1017871875 6:158493659-158493681 CAGGCTGGGCGAGCCCACAGAGG - Exonic
1018860580 6:167708266-167708288 CTGCCTCGCTGGGCTCACTGTGG - Intergenic
1019031711 6:169018971-169018993 CAGCCTGTCTGGGCTCACTGTGG - Intergenic
1019170702 6:170131685-170131707 CAGCCTCGGAGGGACCACAGGGG + Intergenic
1023565101 7:41516336-41516358 CATCCTTGGTGGTCCCAATGAGG + Intergenic
1024563834 7:50665643-50665665 GAGCCTGGGTGGGACCAGGGAGG + Intronic
1026387699 7:69866885-69866907 CAGCCTGGGTTAGCCGGCTGGGG + Intronic
1026849630 7:73716843-73716865 CAGCCTGAGTGGGGCTCCTGGGG + Intronic
1027270939 7:76518392-76518414 CAGCCTCTCTGAGCCCACTGAGG + Intergenic
1027320700 7:77008223-77008245 CAGCCTCTCTGAGCCCACTGAGG + Intergenic
1029248110 7:99217212-99217234 CAGCCGGGCTGGGCACACAGAGG - Intergenic
1029452406 7:100648541-100648563 CAGCCAAGGTGGGGCCTCTGGGG - Exonic
1029491921 7:100875343-100875365 GAGCCTGGGGGGCCCCGCTGGGG + Intronic
1029611288 7:101627858-101627880 CAGCATGGGTGGCCCCACCCTGG - Intronic
1032110635 7:129072314-129072336 CAGGCTGGGTGGGGACTCTGGGG - Intergenic
1034431916 7:151045404-151045426 CAGCCTGGGGGAGCCTACTGGGG + Exonic
1034537025 7:151731736-151731758 CAGCCTAGGTGGGCTTCCTGTGG + Intronic
1035781135 8:2229160-2229182 CAGCCTCTGTGGGCTCAGTGGGG + Intergenic
1035948674 8:3994054-3994076 CAGCTTGGGAAGGCACACTGAGG + Intronic
1036752242 8:11450761-11450783 CAGCCTGGATGGGCTCAGAGAGG + Intronic
1036797823 8:11769033-11769055 CAGCCTGGGTGTTCCCACAATGG - Intergenic
1036847811 8:12181648-12181670 CAGCCAGGGTGGGACCATGGGGG + Intergenic
1036869179 8:12423963-12423985 CAGCCAGGGTGGGACCATGGGGG + Intergenic
1037616156 8:20520524-20520546 CTGCCTGAGTGGGTCCACAGTGG - Intergenic
1037762015 8:21747722-21747744 CTGCCAGGCCGGGCCCACTGCGG + Intronic
1037973515 8:23192167-23192189 CAGTGTGGGTGGGCTCTCTGTGG - Intronic
1038520391 8:28227197-28227219 CAGCCTGGGTGGGCTGAGTCGGG + Intergenic
1038742415 8:30227089-30227111 CTCCTTGGCTGGGCCCACTGGGG - Intergenic
1040556173 8:48479067-48479089 CAGCCTGCATGGGCACAATGTGG - Intergenic
1042895737 8:73665605-73665627 CAGACTGGGTGAGCTCACTTTGG - Intronic
1043882124 8:85555820-85555842 CAGCCAGGGTTGTCCCACTTTGG - Intergenic
1044507172 8:93035654-93035676 CAGCATGGGTGGGCGCAATGGGG - Intergenic
1045676735 8:104615386-104615408 CAGCCTGTCTGGGCTCAGTGTGG - Intronic
1047435342 8:124831233-124831255 CAGCCTGGGAGGGAGCCCTGGGG + Intergenic
1048857263 8:138695660-138695682 TACCCTGGGTGGGCCCAGTATGG + Intronic
1049434308 8:142579408-142579430 CAGCATGGGAGGGCTCTCTGTGG + Intergenic
1049641046 8:143716229-143716251 GAGGTGGGGTGGGCCCACTGTGG + Intergenic
1049725558 8:144144092-144144114 CAGCCAGGGTGAGGCCTCTGTGG + Intergenic
1049749960 8:144278363-144278385 CTGTCTGGCTGAGCCCACTGTGG - Intronic
1049751145 8:144284879-144284901 CTGCCTGGGTGGACCCAGGGTGG - Intronic
1049781888 8:144432835-144432857 CAGCCTGAGTGGGCTCACAGTGG + Intronic
1051583791 9:18705932-18705954 CAGCCTGGGTGGGACCTCATGGG + Intronic
1056732734 9:89179819-89179841 AAGCCTGGCAGAGCCCACTGAGG - Intergenic
1057130740 9:92652895-92652917 CAGAATGGCTGGGCCCACGGTGG + Intronic
1057263393 9:93598644-93598666 CACCCTGGCAGGCCCCACTGAGG + Intronic
1059399944 9:114062601-114062623 TAGCCAGGGTGAGCCAACTGTGG + Intronic
1060550340 9:124482010-124482032 CAGCCTGGGAGGGCCACCTCTGG + Exonic
1061409106 9:130408950-130408972 CACCTTGGGTGGGGCCACTGAGG + Intronic
1061883119 9:133577861-133577883 CAGCCTGGGTGGGCGCTTGGTGG + Intergenic
1061885472 9:133589141-133589163 CATCCTGTGTTGCCCCACTGGGG + Intergenic
1061968985 9:134033665-134033687 GAGCCTGGACGGGCCCCCTGAGG + Exonic
1062049041 9:134437826-134437848 CAGGCTGGGTGGTCCCACCAGGG - Intronic
1062167216 9:135113839-135113861 CAGCCTGGGGGGCACCACAGGGG + Intronic
1062359139 9:136179158-136179180 GAGGCTGGCTGGGCCCTCTGTGG - Intergenic
1062423034 9:136493179-136493201 CAGTGTGGGTGGGCCCCGTGCGG - Intergenic
1062597298 9:137305048-137305070 CCGCCTGGGAGGGCCCAGGGAGG + Intergenic
1062658079 9:137614422-137614444 CAGCCCGGCAGGGCCGACTGGGG - Exonic
1185789764 X:2919846-2919868 CATCCTGTGTGATCCCACTGGGG + Intronic
1192807725 X:74524820-74524842 CAGGTGGGGTGGGCCCACTCTGG - Intronic
1193856793 X:86612345-86612367 CAACCTGTGTGGGCCAGCTGAGG - Intronic
1194374263 X:93112659-93112681 CAGCCTGGCAGGGCCCCCTTTGG - Intergenic
1198255238 X:134918686-134918708 CAGCCTGGGTAGGGCAACTGGGG - Intergenic
1200048014 X:153412868-153412890 CAGCCTGGGTGGCCCCCTTTTGG + Intergenic
1200049149 X:153419544-153419566 CAGCCTTGCTGGGCACACTGGGG - Intronic
1200682290 Y:6226727-6226749 CAGCCTGGCAGGGCCCCCTTTGG - Intergenic