ID: 968226457

View in Genome Browser
Species Human (GRCh38)
Location 3:196975432-196975454
Sequence CAGAAAGATGTTCTGTCTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968226452_968226457 13 Left 968226452 3:196975396-196975418 CCACAGGACTTGGTGACTGTTTT No data
Right 968226457 3:196975432-196975454 CAGAAAGATGTTCTGTCTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968226457 Original CRISPR CAGAAAGATGTTCTGTCTGG GGG Intergenic
No off target data available for this crispr