ID: 968229406

View in Genome Browser
Species Human (GRCh38)
Location 3:196996504-196996526
Sequence GAGGGTTTCAGGGATGGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 620
Summary {0: 1, 1: 0, 2: 1, 3: 65, 4: 553}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968229406_968229415 -4 Left 968229406 3:196996504-196996526 CCTGCCCCATCCCTGAAACCCTC 0: 1
1: 0
2: 1
3: 65
4: 553
Right 968229415 3:196996523-196996545 CCTCCACTCATGCCCATCTCGGG 0: 1
1: 0
2: 0
3: 24
4: 226
968229406_968229419 9 Left 968229406 3:196996504-196996526 CCTGCCCCATCCCTGAAACCCTC 0: 1
1: 0
2: 1
3: 65
4: 553
Right 968229419 3:196996536-196996558 CCATCTCGGGAACTTTCAGCTGG 0: 1
1: 0
2: 0
3: 3
4: 48
968229406_968229420 10 Left 968229406 3:196996504-196996526 CCTGCCCCATCCCTGAAACCCTC 0: 1
1: 0
2: 1
3: 65
4: 553
Right 968229420 3:196996537-196996559 CATCTCGGGAACTTTCAGCTGGG 0: 1
1: 0
2: 0
3: 3
4: 76
968229406_968229413 -5 Left 968229406 3:196996504-196996526 CCTGCCCCATCCCTGAAACCCTC 0: 1
1: 0
2: 1
3: 65
4: 553
Right 968229413 3:196996522-196996544 CCCTCCACTCATGCCCATCTCGG 0: 1
1: 0
2: 2
3: 22
4: 203
968229406_968229421 21 Left 968229406 3:196996504-196996526 CCTGCCCCATCCCTGAAACCCTC 0: 1
1: 0
2: 1
3: 65
4: 553
Right 968229421 3:196996548-196996570 CTTTCAGCTGGGACCAGCTCTGG 0: 1
1: 0
2: 2
3: 18
4: 191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968229406 Original CRISPR GAGGGTTTCAGGGATGGGGC AGG (reversed) Intronic
900141533 1:1141152-1141174 GATGGGGGCAGGGATGGGGCTGG - Intergenic
900492798 1:2961011-2961033 GAGGGTGCCATGGATTGGGCAGG + Intergenic
900563583 1:3320889-3320911 GTGGTTTTGAGGGAGGGGGCTGG + Intronic
900624762 1:3603143-3603165 GAGTTTGGCAGGGATGGGGCTGG - Intronic
900703505 1:4062108-4062130 CAGGGTTGGAGGGATGGGTCGGG + Intergenic
900867361 1:5277855-5277877 GAGGGGTTCAGAGAATGGGCCGG + Intergenic
900901128 1:5516723-5516745 CAGGGTCTCAGGGTGGGGGCTGG + Intergenic
901236122 1:7668542-7668564 GAGGGTTTTGGGGGTGGGGAGGG - Intronic
901728581 1:11261969-11261991 GGGGGAAACAGGGATGGGGCTGG + Intronic
901828452 1:11878067-11878089 GAGGGCTTCAGAGCTGAGGCCGG - Intergenic
902070446 1:13730528-13730550 GAGGGCAACATGGATGGGGCAGG + Intronic
902227632 1:15006758-15006780 GAAAGTTCCAGGGAAGGGGCTGG + Intronic
902375331 1:16027640-16027662 GAGGGTAGAAGGGATGAGGCTGG + Intronic
902380294 1:16049437-16049459 GAGGGTAGAAGGGATGAGGCTGG + Intronic
902635679 1:17733640-17733662 GAGGGTTAGAGGGATGGAGGAGG - Intergenic
903067352 1:20708050-20708072 GAGGATTTGAAGGATGAGGCAGG - Intronic
903290608 1:22311735-22311757 GATGAGTTCAGGGCTGGGGCAGG + Intergenic
903387400 1:22936493-22936515 GAGGGGTCCAAGGCTGGGGCTGG - Intergenic
903469116 1:23573086-23573108 GAGGGAGTCAGGGTTGGGGAGGG - Intergenic
903739749 1:25551980-25552002 GCGGGTGTCAGGGCTGGGGAGGG - Intronic
903884394 1:26532448-26532470 GAGAGGCTCAGGGATGGGGAAGG + Intronic
904597743 1:31657419-31657441 GCTGGTCTCAGGGAGGGGGCCGG - Intronic
904598945 1:31663334-31663356 GAGGATGTCTGGGATTGGGCAGG + Intronic
904997216 1:34640452-34640474 GAGGTTTTCAGTGGTGTGGCAGG - Intergenic
905244898 1:36605937-36605959 GAGGGAGGCAGAGATGGGGCAGG + Intergenic
905469149 1:38178759-38178781 AAGGGTTTCAGGGCTGGGTGCGG + Intergenic
905868753 1:41391165-41391187 CAGGGTGGCAGGGATGGAGCAGG + Intergenic
906243220 1:44255338-44255360 AAGGGTTTCAGAGATGGAGCAGG - Intronic
906262232 1:44402711-44402733 GAGGGTTTTAGGGGTGTGACAGG - Intergenic
906606315 1:47174823-47174845 TAGGGGTTCAGGGAAGGGGGAGG + Intergenic
909049856 1:70754060-70754082 GTGGGTTTCAGGGATGGCACAGG - Intergenic
910204701 1:84737465-84737487 GATGATTTCAGGAATGGGGCAGG + Intergenic
910291665 1:85605815-85605837 CAGGGCTGCAGGGATTGGGCTGG + Intergenic
914245113 1:145879813-145879835 CAGGGTTTCAGGGGTGGAGGCGG - Intronic
914283071 1:146195045-146195067 GAGTGTTACAAGGATGGGGGGGG - Intronic
914752951 1:150548473-150548495 GAGGGATGCAGGGTTGGGGGAGG - Intergenic
915082442 1:153361244-153361266 CAGGGTGTCTGAGATGGGGCAGG - Intergenic
916070245 1:161165840-161165862 GAAGGTTTCGGGGATGGTGCTGG + Intergenic
916515456 1:165512554-165512576 GAGGGCTTCAGGGGTAGGGATGG - Intergenic
916723643 1:167503874-167503896 GTGAGTTTCAGGGATGGGGTAGG + Intronic
916867073 1:168871733-168871755 AAGGGCTTGAGGGATGGGGAGGG + Intergenic
916870625 1:168910889-168910911 GAGGGTTTTGGGCATAGGGCTGG - Intergenic
917699238 1:177563457-177563479 GTGGGTTGCGGGGATGGGGGAGG - Intergenic
919215238 1:194544914-194544936 AAGGCTGTCAGGGGTGGGGCAGG - Intergenic
919778967 1:201210717-201210739 GAAGGTTTCAGGGATGGTTTAGG + Exonic
919778994 1:201210825-201210847 GAAGGTTTCAGGGATGGTTTAGG + Exonic
919787665 1:201270115-201270137 CAGGGATTCAGTGATGGGGCAGG + Intergenic
919935155 1:202246159-202246181 GAGGGATGGAGGGATGGGGGAGG - Intronic
919935201 1:202246280-202246302 GAGGGATGGAGGGATGGGGGAGG - Intronic
920052455 1:203172090-203172112 TGGGGTTTCTGAGATGGGGCAGG + Intronic
921326050 1:213987422-213987444 GGGGGTTTTAGGGGTGGGGGTGG - Intronic
921412232 1:214848078-214848100 GAGGGTATGTGGGATGGGGGAGG - Intergenic
922677811 1:227563531-227563553 GGGGGTTTCCGGGATCTGGCGGG + Exonic
924179171 1:241424130-241424152 GGGGGCTGCAGTGATGGGGCCGG + Intergenic
924728580 1:246692187-246692209 GTGGGTTTCAGGGCTGGGACGGG + Intergenic
1063059182 10:2533048-2533070 CAGCGTGACAGGGATGGGGCAGG + Intergenic
1063255280 10:4320765-4320787 GGGGAGTCCAGGGATGGGGCAGG + Intergenic
1063287847 10:4709652-4709674 GAGGGTCCCAGGGATGGTGGGGG - Intergenic
1063401323 10:5748816-5748838 GAGGGGCTCAGGGCTGAGGCTGG + Exonic
1063531637 10:6838726-6838748 GGGGATTTCAGGGACAGGGCAGG - Intergenic
1064357507 10:14632847-14632869 AAGGGGTTCAGAGATGAGGCTGG + Intronic
1065629153 10:27659852-27659874 GAGGGCTTTAGGGCTGGGCCGGG + Intergenic
1066291037 10:34014640-34014662 GAGTTTTTGAGGGGTGGGGCAGG - Intergenic
1067147015 10:43701416-43701438 AAGGGGTTCAGGGATAGTGCAGG - Intergenic
1067812507 10:49440792-49440814 GGGGGTTACAGGAATGGGGCAGG + Intergenic
1068302631 10:55163831-55163853 GAGTGTTCCAGGAAAGGGGCGGG - Intronic
1068881085 10:62049391-62049413 GAGACTTCCAGGGATGTGGCCGG + Intronic
1069558529 10:69413624-69413646 GTGGGCTTCAGGGATAGGGAAGG - Intronic
1069719284 10:70539459-70539481 GGGGGGGTCAGGGATGGGACTGG + Intronic
1069787584 10:70998537-70998559 GAGTGGTTTAGGGATGGGGGAGG - Intergenic
1070129182 10:73645065-73645087 GGGGTTTTGAGGGATGGGGTGGG + Exonic
1070795727 10:79215221-79215243 TAAGGCTTCCGGGATGGGGCAGG - Intronic
1071061144 10:81571412-81571434 GAGGACTACAGTGATGGGGCTGG - Intergenic
1073444709 10:103573849-103573871 GAAGGTTTCAGGGAGGGAGGGGG - Intronic
1073480411 10:103783133-103783155 GAGGGTGACAGAGATGGGTCTGG + Intronic
1073798232 10:107012231-107012253 GAGGGTGTGAGGGATGAGACTGG - Intronic
1074874799 10:117605335-117605357 GAATGGTTCAGGGATAGGGCAGG + Intergenic
1074921677 10:118020592-118020614 GAGCGGTGCTGGGATGGGGCTGG - Intronic
1075634194 10:124019270-124019292 GGCGGTCTCAGGGCTGGGGCTGG - Intronic
1075706777 10:124506830-124506852 GAGGATTTCAGGTAGGGGGTAGG + Intronic
1076020153 10:127065957-127065979 GCGGGTCTCAGGGAGGGGGACGG - Intronic
1076335266 10:129702594-129702616 CAGGGTTTGAGGGATGGGACAGG + Intronic
1076335481 10:129703798-129703820 CAGGGTTCGAGGGATGGGACAGG - Intronic
1076369242 10:129941055-129941077 GAGAGATTCAGGGAGTGGGCGGG - Intronic
1076613174 10:131738908-131738930 TAGGTTTGCAGGGGTGGGGCAGG - Intergenic
1076623932 10:131810228-131810250 ATGGGTTTCAGGGAAGGGGTCGG + Intergenic
1076733816 10:132450258-132450280 GAGGGTTGCGGGGCTGGGGTGGG - Intergenic
1077063171 11:626548-626570 GAGGGTCTGAGGGCTGGGGCTGG + Intronic
1077080556 11:722903-722925 GTGGGTGTCAGGGCTGGGGGGGG - Intronic
1077225354 11:1437024-1437046 GAGGGCTGCCTGGATGGGGCTGG + Intronic
1077327726 11:1970945-1970967 GAGGGTGGCAGGGGTGGGGCAGG + Intronic
1077394674 11:2315173-2315195 GAGGGGAGCAGGGAGGGGGCAGG - Intronic
1078830903 11:14975329-14975351 GAAGTTTTCAGGAATGAGGCAGG + Intronic
1079351729 11:19697604-19697626 GAGGGAGGCAAGGATGGGGCAGG + Intronic
1080243428 11:30153488-30153510 GAGGGTTCCATGCATGAGGCAGG - Intergenic
1081977681 11:47246055-47246077 GAGTGTTTGGGGGATGGGGAAGG - Intronic
1083148533 11:60775801-60775823 GAGGGCAGCTGGGATGGGGCTGG - Exonic
1083157992 11:60837169-60837191 GAGGGGTCAAGGGATGGGGGAGG - Intergenic
1083275270 11:61593546-61593568 GAGTGTTTCAGGGAAGAGGGAGG + Intergenic
1083399071 11:62411522-62411544 CAGGGTTTCAGGGAGGGAGGGGG - Intronic
1083653834 11:64219664-64219686 GAGGGGCTCAGGGCAGGGGCTGG + Intronic
1083656363 11:64231692-64231714 GAGTGTTTCAGGCATAGTGCAGG - Intronic
1083959085 11:66004025-66004047 GTGGGGGTGAGGGATGGGGCCGG - Exonic
1083962254 11:66021014-66021036 GCGGGGAGCAGGGATGGGGCAGG - Intronic
1084006440 11:66325931-66325953 GAAGGTTCCAGAGATGGGGTGGG - Intergenic
1084290373 11:68161732-68161754 GAGGGTGCCAGGGATGGAGAAGG - Intronic
1084465852 11:69322655-69322677 GATGGTTTCAGTGATGGTACTGG + Intronic
1084712456 11:70852435-70852457 GAGGGTTGCAGGGGAAGGGCAGG + Intronic
1084945311 11:72634981-72635003 CAGGCTGTCAGGGAAGGGGCGGG + Intronic
1085221025 11:74873833-74873855 GAAGGTTTTAGGGAGGGGGAAGG - Intronic
1085415241 11:76315300-76315322 GGGAGTTTCAGGGATGAGGCAGG + Intergenic
1086369080 11:86138749-86138771 GAGGAATTCAGGAATGGGGCTGG + Intergenic
1086407021 11:86507205-86507227 GAGGGGCTCAGGGAATGGGCAGG + Intronic
1087096139 11:94320101-94320123 GTGGGTTGGAGGGATGGGGGAGG + Intergenic
1087794072 11:102437275-102437297 AAGGGTTAAAGAGATGGGGCTGG - Intronic
1087872688 11:103317245-103317267 CAGGGTTGCAGGGTTGGGGGTGG - Intronic
1088953135 11:114590382-114590404 GAGGATTTTAGGGAGGGGGAAGG - Intronic
1089616818 11:119699503-119699525 CAGAGTTGCAGGGGTGGGGCGGG - Intronic
1090269865 11:125378488-125378510 CAGGGGTTCAGGGATGGGGTGGG + Intronic
1090397571 11:126429363-126429385 GAGGGTGGCAGGGCAGGGGCAGG - Intronic
1090555176 11:127866912-127866934 TAGGGTTCCAGGGATGTGGCTGG + Intergenic
1090912621 11:131134769-131134791 GTGGGGTACAGGGATGGAGCTGG - Intergenic
1090946000 11:131430314-131430336 AAGAGTTCCAGGGATGGGGGTGG + Intronic
1202810708 11_KI270721v1_random:26125-26147 GAGGGTGGCAGGGGTGGGGCAGG + Intergenic
1091399951 12:175570-175592 GAGAGTTTCAGGCTTGGGGGCGG - Exonic
1091641443 12:2240491-2240513 TAGGGCTCCAGGCATGGGGCAGG + Intronic
1092235718 12:6807556-6807578 AAGGGGCTCAGGGATGGGGAGGG + Intronic
1092245272 12:6860579-6860601 TTGGGGTTCAGGGATGGGACTGG - Intronic
1093027844 12:14260779-14260801 GAGGCTTGCGGGGGTGGGGCTGG - Intergenic
1093262003 12:16950264-16950286 CTGGGGTTCAGGGAGGGGGCTGG + Intergenic
1093603314 12:21057887-21057909 GAGGGTGGCAGGGATGGGATGGG - Intronic
1093712996 12:22349064-22349086 TAGGGAATTAGGGATGGGGCAGG + Intronic
1093770998 12:23018565-23018587 GAGGGGTTGAGGGATGGGTGAGG - Intergenic
1094044737 12:26154892-26154914 CAGGGTTTGAGGGATGGTGATGG + Intronic
1095939476 12:47716699-47716721 GAGGGTTTCTGTGATTGGCCAGG - Intronic
1096840862 12:54378726-54378748 GAGGGATGCTGGGAAGGGGCTGG + Intronic
1097560526 12:61199361-61199383 GTTGGGTTCAGGGCTGGGGCAGG + Intergenic
1097602650 12:61713550-61713572 GAGGTTGTCAGGGAGGGTGCTGG - Intronic
1098063453 12:66587038-66587060 GAGGGTGTAAGGGATGAGTCTGG - Intronic
1098218019 12:68240350-68240372 GAGGGTTTCAAGCATGAGGAAGG - Intergenic
1098721421 12:73903714-73903736 GTGGGGTGCAGGGATGGGGGAGG - Intergenic
1102010350 12:109614562-109614584 GTGGGTGTCAGGGGTGGGACAGG - Intergenic
1102194176 12:111012663-111012685 GAGGGTTTCAGGAAGGAGGTTGG - Intergenic
1102198192 12:111039332-111039354 GAGGGTGTCAGGGATGGTAGAGG + Intronic
1102528421 12:113528635-113528657 GAGGGAAACAGGGAGGGGGCAGG - Intergenic
1103315737 12:120053668-120053690 GCTAGTTTCAGGGTTGGGGCAGG - Intronic
1103478238 12:121233831-121233853 GTGGCTTTCAGGGCTGGAGCTGG + Exonic
1103506296 12:121443934-121443956 CTGGGTTGGAGGGATGGGGCAGG - Intronic
1103583864 12:121936722-121936744 TAGGGTTTCAGGGAGGGGCCTGG + Intronic
1103993852 12:124816604-124816626 CGGTGTTCCAGGGATGGGGCGGG - Intronic
1104557128 12:129811264-129811286 GTGAGTGTCAGGGATGGGGTGGG + Intronic
1104807136 12:131596827-131596849 GAGGGGTGAAGGGCTGGGGCAGG - Intergenic
1104970627 12:132529140-132529162 GGGGGCTGCAGGGATGGGGTGGG - Intronic
1104974289 12:132545584-132545606 GTGGGTTTCAGGTCTGTGGCTGG - Intronic
1106116415 13:26821470-26821492 GAGGCTTCCAGGGAAGGGCCTGG - Intergenic
1106584594 13:31046019-31046041 GAGGGTTCCAGGGGTGGGGTGGG + Intergenic
1106776069 13:33011059-33011081 GAGCATTCCAGAGATGGGGCAGG + Intergenic
1107916645 13:45158513-45158535 GAGATTTTCACAGATGGGGCTGG - Intronic
1110509292 13:76329907-76329929 TATGTTTTCAGGGATGGGGTGGG - Intergenic
1112347463 13:98602232-98602254 GAGAGTGTCAGGAATGGGGGAGG - Intergenic
1112397122 13:99043408-99043430 TAGGATTTCTGGGCTGGGGCAGG - Intronic
1112397192 13:99043788-99043810 GAGGGCCTCAAGGAGGGGGCAGG - Intronic
1112625423 13:101098163-101098185 GAGGGCTTCAGGGAGGAGGTGGG - Intronic
1113187352 13:107703794-107703816 GGGGGTTTCACGGACAGGGCAGG - Intronic
1113425667 13:110206385-110206407 GAAGGTTTCAGGGATGGCCCAGG + Intronic
1113433566 13:110270892-110270914 GCTGATTTCAGGGGTGGGGCAGG + Intronic
1113676351 13:112210038-112210060 GTGGGGTGCAGGCATGGGGCAGG + Intergenic
1118130857 14:62961735-62961757 GATGGATACAGGGATGGGGATGG + Intronic
1118326724 14:64786376-64786398 GAGGCATTCAGGGCTGGGACAGG - Intronic
1118926785 14:70198442-70198464 GTGGGTTTGAGGGAGGGGGGAGG - Intergenic
1120982211 14:90300139-90300161 GAGGGTCTTAGGAAAGGGGCAGG + Intronic
1121844371 14:97159987-97160009 GAGGAACACAGGGATGGGGCTGG + Intergenic
1122118782 14:99540890-99540912 CAGGGTATCTGGGATGGAGCCGG - Intronic
1122419112 14:101564215-101564237 GTGGATTCCAGGGCTGGGGCGGG + Intergenic
1124071302 15:26395165-26395187 GAGGGTCTCAGGGAGGTGGACGG + Intergenic
1125311317 15:38381480-38381502 GCTGGTTTCAGGGTTGGGACAGG - Intergenic
1125574149 15:40743990-40744012 GACTGATTCAGGGGTGGGGCTGG - Intronic
1125799060 15:42428647-42428669 AAGAGTCTCAGGGATGGGGTTGG - Intronic
1127871903 15:63080778-63080800 GAGGATTTCAGGAATAGGGCAGG + Intergenic
1127903732 15:63360627-63360649 GAGTGTTTTAGGGATGAGGATGG - Intronic
1128229479 15:66024776-66024798 GTAATTTTCAGGGATGGGGCCGG + Intronic
1128864743 15:71105979-71106001 GAGGGTTTGGGGGGTGGGACAGG + Intronic
1129105869 15:73306899-73306921 GAGAGGTTGATGGATGGGGCAGG - Intergenic
1129592368 15:76928578-76928600 GAGGAGTACAGGGAGGGGGCTGG + Intergenic
1129672730 15:77616136-77616158 GAGGGGCTCAGGGAAGGGGCGGG + Intronic
1129882085 15:79013695-79013717 GTGGGCTCCAGGGTTGGGGCAGG + Intronic
1130032565 15:80328903-80328925 CTGGGGTTCAGGGATGGGGATGG + Intergenic
1130034236 15:80342794-80342816 TAAGGGTTCAGGGATGGGGCTGG - Intergenic
1132089926 15:98939886-98939908 CTGGGTTTCACGGCTGGGGCTGG + Intronic
1132418778 15:101645840-101645862 GAGGGTTTCAGGGACAGCACAGG + Intronic
1132603619 16:784597-784619 CAGGGTTTCAGGGCTGGCCCCGG + Intergenic
1132744627 16:1431568-1431590 GAGGGCTTTGGGGATGGGGGAGG - Intergenic
1132752489 16:1465193-1465215 GAGGGTGACAGGGATGGGCACGG - Intronic
1133038172 16:3046231-3046253 GCGGGATACAGGGATGGGGAGGG + Intergenic
1134044914 16:11093921-11093943 GGTGCGTTCAGGGATGGGGCAGG + Intronic
1134303385 16:13011488-13011510 GAGGTTACCAGGGATGGGGTGGG - Intronic
1134490601 16:14693106-14693128 GAGGGTTCTAGGCGTGGGGCAGG + Intronic
1134495982 16:14732223-14732245 GAGGGTTCTAGGCGTGGGGCAGG + Intronic
1135374652 16:21934940-21934962 GAGGGTTCTAGGCATGGGGCAGG + Intergenic
1136154816 16:28375581-28375603 GAGGGTTCTAGGTATGGGGCAGG - Intergenic
1136169084 16:28477432-28477454 GAGGGTCTCTGGGGTGGGCCTGG + Exonic
1136208276 16:28739677-28739699 GAGGGTTCTAGGTATGGGGCAGG + Intergenic
1136243953 16:28962581-28962603 GAGAGCTTCAGGAATGGTGCTGG - Intronic
1136264361 16:29106314-29106336 GAGGGTTCTAGGCATGGGGCAGG + Intergenic
1136285125 16:29236317-29236339 GAGGGTTTCGGGGCGGGGGGGGG + Intergenic
1136636075 16:31524103-31524125 GAGGGTCTCAATGCTGGGGCAGG - Intergenic
1136666367 16:31816474-31816496 GAGGGTCTCAATGCTGGGGCAGG - Intergenic
1137338242 16:47572388-47572410 GAGTGTTACAGGGAGAGGGCTGG - Intronic
1137579562 16:49625502-49625524 GAGGTTCTAAGGGAAGGGGCTGG - Intronic
1137623789 16:49894722-49894744 GAGGGTGCCAGGGCTGGGGGAGG + Intergenic
1138379481 16:56590209-56590231 GAGTTTTTGAGGGATGGGTCGGG - Intronic
1138908204 16:61363868-61363890 GAGGAGTTCCCGGATGGGGCTGG - Intergenic
1138996714 16:62463434-62463456 GAGGGATTCAGGAATCAGGCTGG - Intergenic
1139758585 16:69165725-69165747 GAGGCTCTCGGGGAAGGGGCTGG + Intronic
1140058727 16:71548724-71548746 GAGTGTTTCGGGAAAGGGGCAGG - Intronic
1141806649 16:86346131-86346153 CAGGGTTACGGGGATGGGGGTGG - Intergenic
1141927306 16:87177974-87177996 GGGGGTTGCAGGGAGGAGGCTGG + Intronic
1142161580 16:88560498-88560520 GAGGGTGTCATGAATGAGGCTGG + Intergenic
1142176070 16:88646051-88646073 GAGGGTGTCAGGGCAGGGGCTGG + Intronic
1142181445 16:88672835-88672857 GGGGGTTTCTGGGAAGGAGCTGG + Intergenic
1142359700 16:89620251-89620273 GAGGGAGTCAGGGAGGTGGCTGG + Intronic
1142403691 16:89874102-89874124 GCGGGGCTAAGGGATGGGGCGGG + Intronic
1142693771 17:1622152-1622174 GAAGGTTTAAAGGCTGGGGCCGG - Intronic
1142708963 17:1713263-1713285 GATGGTATCAGGGATGGGGGAGG + Intergenic
1142886036 17:2912510-2912532 GAGCCTTTCTGGGCTGGGGCAGG + Intronic
1143476078 17:7204708-7204730 GGGGGTTGGGGGGATGGGGCAGG - Intronic
1143796245 17:9339158-9339180 TAGGGTTTCTGGGATGGCTCTGG - Intronic
1144282962 17:13745102-13745124 GAGGGAAGAAGGGATGGGGCTGG - Intergenic
1144621846 17:16823098-16823120 GTGTATTTCAGGGATGGGACAGG - Intergenic
1144627159 17:16849870-16849892 GAGGGTTTAGGGGATGGTTCTGG - Intergenic
1144879278 17:18422842-18422864 GAGGGTTTAGGGGATGGTTCTGG + Intergenic
1144884578 17:18449616-18449638 GTGTATTTCAGGGATGGGACAGG + Intergenic
1144997670 17:19281721-19281743 GAGGGTTTGAGGGTGGGGGGTGG + Intronic
1145091209 17:19987610-19987632 GAGGTTTCCAGGAAAGGGGCAGG - Intergenic
1145147652 17:20494761-20494783 GTGTATTTCAGGGATGGGACAGG - Intergenic
1145152959 17:20521545-20521567 GAGGGTTTAGGGGATGGTTCTGG - Intergenic
1146417381 17:32648497-32648519 GATAGTTTCAGGATTGGGGCTGG + Intronic
1147341816 17:39756752-39756774 GAGGGATTTGGGGATGGGGAAGG + Intergenic
1147425897 17:40345718-40345740 GAGGTTAGCAGGGATGGGCCAGG + Intronic
1147976242 17:44249741-44249763 GAGGGTCTCAAGGTAGGGGCTGG + Exonic
1148780541 17:50118750-50118772 GAAGGGTTGAGGGATGAGGCTGG + Intronic
1148801149 17:50226816-50226838 GTTGGTTTCAAGGCTGGGGCAGG + Intergenic
1149556024 17:57574138-57574160 GAGGATATGAGGGGTGGGGCTGG - Intronic
1149607502 17:57935570-57935592 GAGGGCAGCGGGGATGGGGCGGG - Intronic
1149609376 17:57949033-57949055 GTGGGTTTCAGAGAAGGGTCAGG - Intronic
1149883724 17:60319078-60319100 GAGGGTTTAGGGGAAGGGGTTGG + Intronic
1150272333 17:63874422-63874444 GATGGTTTCAGGGCTGTGGGAGG - Intronic
1150641720 17:66953904-66953926 GATGCTCCCAGGGATGGGGCTGG + Intergenic
1150845965 17:68658248-68658270 GAGATTTTCAGGGCTGTGGCTGG - Intergenic
1151435083 17:74090271-74090293 GAGCTCTTCAGGGATGGGGCAGG - Intergenic
1151475622 17:74342983-74343005 GAGGGTGACCGGGGTGGGGCTGG - Intronic
1151787195 17:76280797-76280819 CAGGGTGGCTGGGATGGGGCCGG - Intronic
1151851306 17:76691637-76691659 GTTGGTTGCAGGGGTGGGGCTGG + Intronic
1152190351 17:78884173-78884195 GCGGGTTGCAGGGATGGGTAGGG - Intronic
1152821802 17:82441298-82441320 GAGGGGGGCAGGCATGGGGCGGG + Intronic
1152856329 17:82666692-82666714 GAGGGTTTGAGTTAAGGGGCTGG + Intronic
1153472559 18:5463361-5463383 CACAGTTTCAGGGATGGTGCAGG - Intronic
1154026105 18:10708580-10708602 GCGGGGCTCAGGGATGGGGATGG + Intronic
1154139122 18:11807769-11807791 GAGGGATCCAGGGTTGGTGCTGG - Intronic
1156305597 18:35875557-35875579 GAGGGTTTTAGGGAGGGGGAAGG - Intergenic
1156391007 18:36650713-36650735 GAGGGTTTAAGGGTTTGTGCAGG - Intronic
1157083042 18:44549010-44549032 TGGGGTTTCAGAGGTGGGGCGGG + Intergenic
1157468662 18:47970426-47970448 AAGGGGGTCAGGGATGGGGCAGG + Intergenic
1157544987 18:48540573-48540595 GGAGTTTTCAGGGTTGGGGCTGG + Intronic
1157913799 18:51644563-51644585 GAGTGTGTCAGGGGTGAGGCTGG + Intergenic
1158517053 18:58139302-58139324 GAGGGTCTCCTGTATGGGGCGGG - Intronic
1160068787 18:75606234-75606256 TAGGCTTTCAGGGATGGAGTTGG + Intergenic
1160488474 18:79316274-79316296 GATGCTCTCAGGGATGGCGCAGG - Intronic
1160614329 18:80112660-80112682 GAGGCTCTCAGAGATTGGGCAGG - Intronic
1160734694 19:657196-657218 GAGAGATTCGGGGCTGGGGCTGG - Intronic
1160786220 19:901234-901256 GAAGGTTCCAGGGGTGGGGTGGG + Intronic
1160798561 19:956746-956768 GAGGCCTTCCGGGAAGGGGCTGG - Intronic
1160833334 19:1113310-1113332 GGGGCTTAGAGGGATGGGGCAGG + Intronic
1160897979 19:1411727-1411749 GAGGAGTTGAGGGATGGGCCCGG + Intronic
1160980151 19:1812872-1812894 GAGGGTGTCAGGGCAGGGCCGGG + Intergenic
1161164438 19:2778555-2778577 CAGGGTAACAGGGATGGGGTAGG - Intronic
1161269612 19:3382615-3382637 GAGGGTCTGAGGGAGGAGGCTGG + Intronic
1161321863 19:3645166-3645188 GGGGGTTGCAGGGAGGTGGCAGG - Intronic
1161331305 19:3688931-3688953 GAGAGTGCCCGGGATGGGGCTGG + Intronic
1162143195 19:8596840-8596862 GAGGGAGCCAGGGATGGGGAGGG - Intronic
1162742900 19:12783342-12783364 GAGGTTTGCAGGGGTGGGGGTGG - Intronic
1162923901 19:13919948-13919970 GAAGGTTTGAGGGTTGGGGCCGG + Exonic
1163609499 19:18293546-18293568 GATGTTTTCAGGGACAGGGCGGG - Intergenic
1163773687 19:19205688-19205710 GCTGGTCTCAGGGCTGGGGCTGG + Intergenic
1163999241 19:21082174-21082196 GACGGCTTCGGGGATGTGGCGGG + Intronic
1164005166 19:21142011-21142033 GACGGCTTCCGGGATGTGGCGGG + Intronic
1164026618 19:21358961-21358983 GACGGCTTCCGGGATGTGGCGGG + Exonic
1164030239 19:21397107-21397129 GACGGCTTCCGGGATGTGGCTGG + Exonic
1164594614 19:29525335-29525357 GGAGGTTTCCGGGAGGGGGCGGG - Intergenic
1165149175 19:33750904-33750926 GAGGGTTGCAGGGCTGGGTGGGG - Intronic
1165741597 19:38207999-38208021 GAGGGTCTAAGGGGTGGGGGTGG - Exonic
1166254649 19:41594458-41594480 GAGGGTCTCAGGGATGAGAGTGG + Intronic
1166631150 19:44409182-44409204 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
1166632027 19:44415309-44415331 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
1166632455 19:44418994-44419016 GAGGGTTGCAAGGATGCTGCTGG + Intronic
1166637024 19:44459399-44459421 GAGGGTTGCAAGGATGCTGCTGG - Intergenic
1166653456 19:44592813-44592835 GAGTATTTCAGGAAAGGGGCAGG - Intergenic
1167114279 19:47479985-47480007 GATGGTTTCAGGGCTGCGGGCGG - Intronic
1167161896 19:47773338-47773360 GAGGGGCTCAGAGGTGGGGCAGG + Intergenic
1167267874 19:48492585-48492607 GTGGGCTTCAGAGATGGAGCAGG - Intronic
1167286980 19:48603771-48603793 GAGGGTTTCTGGGGGGGCGCAGG + Exonic
1167396833 19:49235028-49235050 GGGGGCAGCAGGGATGGGGCTGG + Intergenic
1167592683 19:50413048-50413070 CTGGCTTCCAGGGATGGGGCTGG + Intronic
1167621296 19:50562488-50562510 GAGGGTTTGAGGCAAGGGGAGGG + Intronic
1168127540 19:54294282-54294304 GATGCTTTCAGTTATGGGGCTGG - Intergenic
1168169582 19:54576603-54576625 TGGGGCTTCAGGGATGGGGCAGG + Intronic
1168252543 19:55148779-55148801 GAGGGTATCAGGAATTGGGGGGG - Intronic
1168291404 19:55359420-55359442 GAGGCCTTCCGGGATGGAGCAGG + Exonic
1168615705 19:57835322-57835344 GAGGGTTTCAGGTATGACGCTGG + Intronic
1168621078 19:57880126-57880148 GAGGGTTTCAGGTATGACGCTGG - Intronic
925200670 2:1965546-1965568 GAGTTTATCAGGGATGGGGTAGG + Intronic
925537904 2:4935992-4936014 AAGGCTTTCAGGGATGAGTCAGG - Intergenic
926437924 2:12856353-12856375 GAGGGATTCAGTGCTGTGGCTGG + Intergenic
926690908 2:15732732-15732754 GAGGGTTCTAGAGATGGGGTGGG + Intronic
927518714 2:23686775-23686797 GAGGTTTGTAGAGATGGGGCTGG + Intronic
927640124 2:24840812-24840834 GAGGGGCTCAGGGATGAGGCTGG - Intronic
927673828 2:25090245-25090267 GAGGACTTCAGGGAGGGGCCCGG - Intronic
927932628 2:27054988-27055010 GGGGGTGTCATGGATGAGGCAGG - Intronic
927967870 2:27282900-27282922 GTGGGTGCCAGGGACGGGGCAGG + Intronic
928670472 2:33598823-33598845 GAGGGGTTAAGGGGTAGGGCAGG + Intronic
928985533 2:37177523-37177545 GGTGGTTACAGGGATGGGGAAGG + Intronic
928998659 2:37324554-37324576 GGGGGTTTGGGGGATGGGGGAGG + Intronic
929011346 2:37447962-37447984 GAGGATGTCAGGGCTGGGGGTGG + Intergenic
929683550 2:44015231-44015253 GAAGGTTTCATGGAGGAGGCAGG + Intergenic
929777778 2:44939268-44939290 GGGGGTTTCGGGGACGGGGAGGG + Intergenic
930156434 2:48111777-48111799 CAGGGCTCCAGGGGTGGGGCTGG - Intergenic
931117686 2:59182387-59182409 GAGACTTCCTGGGATGGGGCTGG + Intergenic
931867063 2:66425021-66425043 GATGGAGTCAGGGATGGAGCAGG + Intergenic
931891633 2:66679474-66679496 GAGGTGGTCAGGGATGGGGAAGG + Intergenic
932703300 2:74004952-74004974 GATGGACTCAGGGAGGGGGCAGG + Intronic
933632428 2:84673071-84673093 GAGGGATTCAGGGGTGGGGCTGG + Intronic
933748611 2:85588754-85588776 GAGGATGGGAGGGATGGGGCAGG - Intronic
933749780 2:85595885-85595907 GCAGGTTTCTGGGCTGGGGCTGG + Intronic
933758666 2:85659992-85660014 CAGGGTTTCAGGAACAGGGCTGG + Intronic
934905496 2:98197824-98197846 GTGGATTTCAGGGCTGAGGCTGG - Intronic
934973943 2:98787177-98787199 GAAGGGCTCAGGGGTGGGGCTGG + Intergenic
935754581 2:106266986-106267008 GTTGGTTCTAGGGATGGGGCAGG + Intergenic
936113946 2:109687399-109687421 GCTGGTTCTAGGGATGGGGCAGG - Intergenic
936251231 2:110869868-110869890 GAGGGTATCTGGGTAGGGGCTGG - Intronic
936385585 2:112025492-112025514 GAGGGTTTCTGAGATGGGGAAGG - Intronic
938069796 2:128302451-128302473 GATGGTCACAGGGCTGGGGCTGG - Intronic
938306917 2:130262824-130262846 CTGGGTTTCAGGGTTGGAGCTGG - Intergenic
938540996 2:132283388-132283410 GAGGGTTGCAAGGATGCTGCTGG - Intergenic
940989696 2:160085059-160085081 GAGGGTTTTAGGGAGGGGAAAGG + Intergenic
941007873 2:160265801-160265823 GAGAATTCCAGGGCTGGGGCAGG + Intronic
941099481 2:161280937-161280959 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
941297968 2:163764200-163764222 GATGGTTACAGGGATGTGGGGGG - Intergenic
941712571 2:168729564-168729586 GAAGGTTTCTGGGATGGTTCTGG - Intronic
942100621 2:172579229-172579251 GATGTTTCCAGGGATGGGGGTGG + Intronic
942231026 2:173860976-173860998 GAGGATTTCCTGGAAGGGGCTGG + Intergenic
942683703 2:178508775-178508797 GAGGATTTGGGGGGTGGGGCCGG - Exonic
942946852 2:181682148-181682170 GAGGGTTTCAGGTCTGGGAGGGG - Intergenic
944836089 2:203581328-203581350 GTGGGTTGGGGGGATGGGGCGGG - Intergenic
945519027 2:210800073-210800095 AGGGTTTTAAGGGATGGGGCTGG - Intergenic
946332677 2:219019196-219019218 AAGGGGTTCAGAGATGGGGATGG + Intronic
947508022 2:230724868-230724890 GTGGGGGTGAGGGATGGGGCCGG + Intronic
947713855 2:232330280-232330302 GAGGCTTTCAGAGTCGGGGCTGG + Intronic
948214619 2:236219567-236219589 TAGTGTTTCAAGGATGGGCCTGG - Intronic
948266544 2:236639000-236639022 GGGGGTTGCAGGGGTGGGGGTGG + Intergenic
948609244 2:239156252-239156274 GTGGCCTTCAGGGATGGCGCTGG - Intronic
948856284 2:240732045-240732067 GAGGGGATGAGGGATGGGGGAGG + Intronic
1168955210 20:1829786-1829808 GAGGGCTCCAGGGCTGGGCCAGG + Intergenic
1169217462 20:3801862-3801884 GTGGATTTGAGGGATGGGACGGG + Intronic
1172409871 20:34713009-34713031 GAGGGTTCCAGGCAGGGGGCTGG - Exonic
1172522711 20:35578801-35578823 AAGGGTCCCAGGGAGGGGGCTGG - Intergenic
1172588950 20:36104328-36104350 GAGAGTTTCAGGAAGGAGGCGGG + Intronic
1172786602 20:37472916-37472938 GAAGGTGGCAGGGATGGTGCTGG + Intergenic
1172836755 20:37878105-37878127 GGGGGTTTCCTGGATGGGGCTGG - Intergenic
1172924953 20:38525095-38525117 AAGGATTTCAGGGATGAGGTGGG - Intronic
1173666685 20:44768102-44768124 CAAGGTGTCAGGGATGGGGAAGG - Intronic
1174180075 20:48669036-48669058 GAGGGCTGCAGGGAGGTGGCAGG - Intronic
1174921910 20:54712438-54712460 GCTGGTTTCAGGCATGTGGCTGG + Intergenic
1175195696 20:57241858-57241880 AAGGGTTTAGGGGATGGGGCAGG + Intronic
1175236841 20:57519785-57519807 GAAGGATGCAGAGATGGGGCGGG - Intronic
1175445143 20:59014882-59014904 GAGGGTTTCAGGCTCAGGGCTGG + Intergenic
1175875422 20:62227309-62227331 GAGGGCTCCTGGGCTGGGGCTGG - Intergenic
1175931694 20:62496573-62496595 GAGGGTTGCAGGGTGGGGGTGGG + Intergenic
1175949851 20:62577614-62577636 GAGGGCAGCAGGGCTGGGGCTGG + Intergenic
1178441935 21:32605406-32605428 CTGGGTTTCAAGGAAGGGGCTGG + Intronic
1178883649 21:36467672-36467694 GAGGGGTGCAGGGATGGGATGGG + Intronic
1180030447 21:45203081-45203103 GAGTGTCTCAGGGGAGGGGCTGG - Intronic
1180126481 21:45793893-45793915 CAGGGTATTAGGGATGAGGCTGG - Intronic
1180708218 22:17822603-17822625 GAGGGGGTCAGGGACGAGGCTGG - Intronic
1181513966 22:23401194-23401216 GAGGTCCCCAGGGATGGGGCTGG + Intergenic
1181528518 22:23502959-23502981 GAGGGATGGAGGGATGGGGATGG - Intergenic
1182294350 22:29304503-29304525 GAGGGTTGCAGGTTTGGGGTGGG - Intergenic
1182979246 22:34652714-34652736 TAGGGTCTCAGGGCTGGGGGTGG + Intergenic
1183009521 22:34933210-34933232 GTGGGTTACAGGGATGGGAGGGG + Intergenic
1183390992 22:37545720-37545742 GAGCGTGTGGGGGATGGGGCAGG + Intergenic
1183622994 22:38985743-38985765 GAGGAGTGCAGGGGTGGGGCAGG - Intronic
1183630920 22:39032068-39032090 GAAGCCTGCAGGGATGGGGCCGG + Intronic
1183632999 22:39044872-39044894 GAGGAGTGCAGGGGTGGGGCAGG - Intronic
1183661643 22:39224909-39224931 CAGGGGTTCAGGGATCAGGCAGG + Exonic
1184080370 22:42215046-42215068 CAGGGTTTCAGGAAAGAGGCTGG - Exonic
1184092037 22:42297921-42297943 GCTGGTTTCAGGGCTGGGCCTGG + Intronic
1184353464 22:43961055-43961077 GAGGCTTTTAGGGAAGGGCCTGG + Intronic
1184493195 22:44822294-44822316 GAGGGTTGCAGGGAGGGAGGGGG - Intronic
1184726163 22:46347870-46347892 GAAGGCTGCAGTGATGGGGCAGG + Intronic
1184938093 22:47739811-47739833 GGGGGCATCAGGGATGGGCCTGG + Intergenic
1185003139 22:48258517-48258539 GTGGGCTTGAGGGATGGGGGTGG - Intergenic
1185013933 22:48332861-48332883 GAGGGTTTCAGGGTCGGGGTCGG - Intergenic
1185275400 22:49948383-49948405 CAGGGTGTCTGGGTTGGGGCGGG + Intergenic
1185370817 22:50460105-50460127 GAGGGCTTCAGGGCTGAGGACGG + Exonic
949791709 3:7799852-7799874 GAGGGAGTCAAGGATGAGGCTGG - Intergenic
950568445 3:13785700-13785722 GAGGGTGGCAGGGATGTGCCTGG - Intergenic
950900924 3:16496802-16496824 GGCGGTTTCCAGGATGGGGCTGG - Intronic
951623271 3:24630157-24630179 GAGGATTCCAGGGCTGAGGCAGG - Intergenic
951781530 3:26368635-26368657 GAGGGTTTTAGGGATGCTGGAGG + Intergenic
953435283 3:42872881-42872903 GAGTGGTTCAGGGAAGAGGCAGG + Exonic
954021919 3:47749777-47749799 GAGGGATAGAGGGAGGGGGCAGG + Intronic
954022232 3:47752355-47752377 GGGGGTTTATAGGATGGGGCTGG - Intronic
954375879 3:50193960-50193982 CGGGGTATCAGGGAAGGGGCAGG - Intronic
955491586 3:59488380-59488402 GAGGGTTGCATGGATGTGGAAGG + Intergenic
956873504 3:73440742-73440764 GAGTGTCTCGGGGATGGGACAGG + Intronic
956916888 3:73881057-73881079 GAAGGATTCAGGGCTGGGGATGG + Intergenic
959905161 3:111703212-111703234 GAGGGATGCAGGGATGGTGCTGG + Intronic
959945391 3:112120327-112120349 GATAGTCTCAGGGATGGGGAAGG - Intronic
961494976 3:127284713-127284735 GAGGGGTTCAGGGAGGGCCCAGG + Intergenic
961722662 3:128906999-128907021 GTGAGTTGCAGGGATGAGGCCGG + Intronic
962046231 3:131762118-131762140 GAGGATTTGATGGAAGGGGCAGG - Intronic
962479673 3:135787520-135787542 GAGGCTCCCAGGGATGGGGATGG + Intergenic
963010940 3:140769772-140769794 GAGGAGTGCAGGGATGGTGCAGG - Intergenic
963642924 3:147880667-147880689 GAGGGTTTGGGGGATGGGAAAGG + Intergenic
963761766 3:149292151-149292173 GAGGGTTTTAGGGAAGGGAAAGG - Intergenic
963815279 3:149823963-149823985 GCTGATTTCAGGGCTGGGGCAGG + Intronic
963848466 3:150183250-150183272 GATGGTCTCAGTGATGGGGATGG + Intergenic
966593817 3:181709715-181709737 GCTGGTTTCAGGGATGTGGCTGG - Intergenic
966744200 3:183260082-183260104 GAGGAACACAGGGATGGGGCTGG + Intronic
966794279 3:183698439-183698461 TGGGGGTCCAGGGATGGGGCCGG + Intronic
966862707 3:184239490-184239512 GAGGGTTTCCGGGGTCGGCCGGG - Exonic
967101030 3:186215980-186216002 GGGGGTTTGGGGGGTGGGGCAGG - Intronic
968207101 3:196812905-196812927 CATGGTTTCGGGGGTGGGGCTGG + Intronic
968229406 3:196996504-196996526 GAGGGTTTCAGGGATGGGGCAGG - Intronic
968348011 3:198027520-198027542 GAGGCTGTCAGGGCTGGGGGAGG - Intronic
968483955 4:849842-849864 GAGGCCTTCAGGGGCGGGGCGGG - Intronic
968579815 4:1384716-1384738 GAGGGTTTCTGGGATGGCGATGG - Intronic
968606234 4:1537005-1537027 GAAGGCTGCAGGGATGGGTCTGG - Intergenic
968628656 4:1639046-1639068 GAGGGCGTCAGAGATGAGGCAGG - Intronic
968634681 4:1671905-1671927 GCTGATTTCAGGGCTGGGGCAGG + Intronic
968656968 4:1782857-1782879 GAGGGGCTCAGGGAGGGGGCTGG + Intergenic
969087813 4:4669539-4669561 GAGGGTGACAGGTAAGGGGCGGG - Intergenic
969254188 4:5991377-5991399 AAGGCTCTCATGGATGGGGCTGG + Intergenic
969384316 4:6833365-6833387 GAAGTTTTCAGGGATAGGGAAGG - Intronic
969515571 4:7646289-7646311 GAGGACTTCAGGGGTGGGGGTGG + Intronic
969860546 4:10032357-10032379 GAGGGTTTCAGGGACTGGTGTGG + Intronic
969922719 4:10556000-10556022 GAGGCTTTTGGGGGTGGGGCAGG - Intronic
971302390 4:25452434-25452456 CAGGGTCTCGGGGATGGGGTGGG + Intergenic
971938975 4:33189434-33189456 GAGGGCTGCCAGGATGGGGCTGG - Intergenic
976134381 4:81920210-81920232 GATGGTTGCAGGGAAGGGACTGG - Intronic
978402467 4:108345138-108345160 GAGTTTTTCAGGGATAGGTCTGG - Intergenic
979429842 4:120616096-120616118 GAATGCTTCAGGTATGGGGCAGG - Intergenic
980707178 4:136514015-136514037 GAGGGTATTAGGAATGGGCCTGG - Intergenic
981018886 4:140004529-140004551 GAGGGGTTTGGGGAGGGGGCAGG + Intronic
981307575 4:143262977-143262999 GAGGGTTTGGGGTAGGGGGCAGG + Intergenic
981486416 4:145291341-145291363 GTGGTTTCCAGGGATGTGGCTGG - Intergenic
981684140 4:147434500-147434522 GAGGGTGGCAGGGATGGGGGTGG - Intergenic
983081242 4:163387607-163387629 GAGGGTGTCAGGGGAGGGGAAGG + Intergenic
983400004 4:167250765-167250787 GATGGTGTCAGGTATGGGGATGG - Intergenic
983943287 4:173558627-173558649 GAGAGCTTCAGGGATAGGACAGG + Intergenic
984999673 4:185471249-185471271 GCGGGTTTGAAGGCTGGGGCGGG + Intronic
985348887 4:189036625-189036647 GAGGGCTTCTGGGATGGGAAGGG - Intergenic
985472999 5:57761-57783 GGGGGTTTCTGGGAGGAGGCAGG - Intergenic
992725870 5:79606827-79606849 GAGGGTGTAGGGGATGGGGAAGG - Intergenic
995553928 5:113308476-113308498 GAGGTTTTTAGAGATGGGGATGG - Intronic
995577245 5:113551605-113551627 GAGGGGTTCCGGGATAGGGGAGG + Intronic
995902105 5:117081884-117081906 GTGGGTTTCTAGGATGGGGGAGG + Intergenic
997242516 5:132318295-132318317 GAGGGTGTCTGGCATGTGGCAGG - Intronic
997306159 5:132838178-132838200 AATGGTTTCAGGCCTGGGGCTGG - Intergenic
997511673 5:134458818-134458840 GATGGTTCCAAGGGTGGGGCTGG + Intergenic
998590929 5:143477297-143477319 CAGGATGTCTGGGATGGGGCTGG + Intergenic
998824111 5:146083753-146083775 CAGAGTATCAGGGATGGGGCAGG - Intergenic
999109317 5:149104236-149104258 GATAGTTTCAGGGTGGGGGCTGG - Intergenic
999215919 5:149934948-149934970 GTGGGTTCCAGGGATGGGAGTGG + Intronic
999267299 5:150275254-150275276 GAGAGTCTCAGGGAGGGGACTGG - Intronic
1000244528 5:159438365-159438387 CAGGCATCCAGGGATGGGGCGGG + Intergenic
1001155789 5:169271538-169271560 GAGGGTTTCAGGAAGGAGGCAGG + Intronic
1002104851 5:176874961-176874983 GAGGGTTTCGGTGCTGGGGTGGG - Intronic
1002297395 5:178239191-178239213 GAAGGTTTCAGTGATGGGGATGG + Intronic
1002297562 5:178239991-178240013 GAGGGTTTTAAGGATGGCCCAGG + Intronic
1002319744 5:178367916-178367938 GAGGGGCTCAGGGCTGGGCCAGG + Intronic
1002922254 6:1581015-1581037 GAGGGAGTCAGGCCTGGGGCGGG + Intergenic
1002948950 6:1789357-1789379 TATGGTTTCAGGGTGGGGGCTGG - Intronic
1002969594 6:2000458-2000480 GTGGGTTTTAGGGATTGGGGAGG - Intronic
1003619812 6:7689806-7689828 CTGAGTTTCAGGGTTGGGGCAGG + Intergenic
1003696441 6:8410408-8410430 GATAGTTTCAGGGTTGGGGCTGG - Intergenic
1004143649 6:13045045-13045067 GAGGGCTTCAGGGATGAGGGAGG - Intronic
1005969318 6:30749043-30749065 GAGGGTAGCAGGAATGGGGATGG - Intergenic
1006152256 6:31995825-31995847 GAGGGGGTCAGGGCTGGGGCAGG + Intronic
1006158559 6:32028563-32028585 GAGGGGGTCAGGGCTGGGGCAGG + Intronic
1006334785 6:33414909-33414931 GGGGGTGTCCGGGAGGGGGCTGG + Intronic
1006370295 6:33640148-33640170 CAGGGTCTCAGGGCTGGGACAGG + Intronic
1006424177 6:33953885-33953907 AAAGGTTTCAGGGTTGGGGTGGG + Intergenic
1006884454 6:37369245-37369267 GTGGTCTTCAGGGGTGGGGCAGG + Intronic
1007077817 6:39079033-39079055 GATGGTGTCAGGGATGGGAGTGG + Intronic
1007240331 6:40420260-40420282 CAGGGTCTCAGAGGTGGGGCAGG - Intronic
1007240981 6:40425079-40425101 GAGTTTTGCAGGGCTGGGGCAGG - Intronic
1007250094 6:40489595-40489617 AAGGGGTTGAGGGATGAGGCAGG + Intronic
1007290250 6:40780415-40780437 GGGGGCTTCAGGGGAGGGGCTGG - Intergenic
1007500846 6:42295600-42295622 GAGGGCTTCCTGGATGAGGCTGG - Intronic
1007504097 6:42321199-42321221 GGGGGTCTCAGGGTTGGGGCTGG - Intronic
1007534699 6:42576090-42576112 GTTGATTTCAGGGTTGGGGCAGG - Intronic
1008692838 6:54000182-54000204 GAGACTTTAAGGGATGTGGCTGG + Intronic
1010215402 6:73396736-73396758 GTGGGTCCCTGGGATGGGGCAGG - Intronic
1010396674 6:75400710-75400732 GGGAGATTCAGGGATGGGGGAGG + Intronic
1011260389 6:85464516-85464538 GTGGGTGTCAGGAATGAGGCTGG + Intronic
1011451118 6:87493270-87493292 TATGATTTCAGGGTTGGGGCAGG - Intronic
1013269046 6:108528670-108528692 GAGAGTTGCAAGGTTGGGGCTGG - Intergenic
1018176254 6:161181715-161181737 GGGAGATTCTGGGATGGGGCAGG - Intronic
1019390918 7:786703-786725 GGGGGTGTCAGGGTTGGGGGAGG + Intergenic
1019391069 7:787165-787187 GAGGGTGTCAGGGTTGGGTGAGG + Intergenic
1019512337 7:1424022-1424044 GAGGGTGGGCGGGATGGGGCTGG - Intergenic
1020129853 7:5553587-5553609 CAGGGTGTCAGGGCTGTGGCTGG - Intronic
1020792246 7:12641377-12641399 CATGGCCTCAGGGATGGGGCTGG + Intronic
1022141697 7:27498702-27498724 GATGGTGTCCGGGCTGGGGCAGG - Intergenic
1022431579 7:30328055-30328077 GAGGGTTACAGAGAGGTGGCAGG + Intronic
1022465495 7:30650380-30650402 GAGGGATTCAGGGCTGGGGTTGG + Intergenic
1022743805 7:33149163-33149185 GAGGCTTTCATTGATGGAGCAGG + Intronic
1023040174 7:36166004-36166026 GAGGGATTCAGGCAGGGGGATGG + Intronic
1023732539 7:43205967-43205989 GAGGGTGTCCTGGATGGGGAGGG - Intronic
1024473183 7:49784275-49784297 AAAGGTGTCAGGGATGGGGAGGG - Intronic
1024573940 7:50748523-50748545 CAGGGTACCAGGGATGGGGTCGG + Intronic
1028608895 7:92686285-92686307 TGGGGATTCAGGGAAGGGGCGGG - Intronic
1030196684 7:106859655-106859677 CAGGGACTCAGGGATGGGTCTGG + Intergenic
1030696263 7:112588403-112588425 GAGTGCCTGAGGGATGGGGCAGG + Intergenic
1031013634 7:116549229-116549251 GGGGGCTTCAGGGAGGAGGCAGG - Intronic
1032067913 7:128785639-128785661 GAGGGTTTCAGGAATTTGGCTGG - Intergenic
1033304446 7:140214226-140214248 GAGGGTTTCAGCCATGTGGTTGG + Intergenic
1034422122 7:150995783-150995805 GAGGGGTGCAGGGGTGGGTCGGG - Intronic
1034422137 7:150995816-150995838 GAGGGATGCAGGGGTGGGACGGG - Intronic
1034422180 7:150995915-150995937 GAAGGGTGCAGGGATGGGACAGG - Intronic
1034422191 7:150995947-150995969 GAAGGGTGCAGGGATGGGACGGG - Intronic
1034422203 7:150995979-150996001 GAGGGGTGCAGGGATGGGACGGG - Intronic
1034422256 7:150996113-150996135 GAGGGGTGCAGGGGTGGGGTAGG - Intronic
1034560824 7:151878031-151878053 GAGGGGTTGGGGGAGGGGGCTGG + Intergenic
1034954783 7:155327680-155327702 GGGGGTTTCAGGTCTGGGTCTGG - Intergenic
1035260669 7:157659454-157659476 GATGGTCACAGGGATGGGGGGGG + Intronic
1035580732 8:737922-737944 GAGGGCGTCAGGGTTGGGGGCGG + Intronic
1035683105 8:1503292-1503314 GGGGGTTCCAGGGCTGGGGAGGG - Intronic
1036229389 8:6986496-6986518 GAGGGGATAAGGGATGAGGCCGG - Intergenic
1036231840 8:7005599-7005621 GAGGGGATAAGGGATGAGGCCGG - Intronic
1036560651 8:9898388-9898410 GAGGGTTGCGGGGGTGGGGAAGG + Intergenic
1036613223 8:10367810-10367832 GAGGGTAACTGGGATGAGGCAGG + Intronic
1037749563 8:21672239-21672261 GAGGGTCTCGAGGCTGGGGCAGG + Intergenic
1039406612 8:37318530-37318552 GTGGGTGTCAGGGATGGGCAGGG + Intergenic
1040103963 8:43529155-43529177 GAGGTTTGGAGGGACGGGGCAGG + Intergenic
1040289719 8:46118021-46118043 GAGGGCTTCGGGGATGGGAGAGG + Intergenic
1040300117 8:46183575-46183597 GGGGGCTTCTGGGATGGGGGAGG + Intergenic
1040304972 8:46207329-46207351 GAGGGCTTCTGGGATGGGAGAGG - Intergenic
1040305842 8:46211373-46211395 GCGGGTTTCTGGGATGGGAGAGG - Intergenic
1040306318 8:46213749-46213771 GGGGGTTTCTGGGATGGGAGAGG - Intergenic
1040307089 8:46217669-46217691 GGGGGCTTCTGGGATGGGACAGG + Intergenic
1040313462 8:46248824-46248846 GGGGGTTTCTGGGATGGGGGAGG - Intergenic
1040317724 8:46273797-46273819 GAGGGTTTCTGAGATGGGAGAGG - Intergenic
1040317985 8:46275090-46275112 GAGGGCTTCTGGGATGGGAGAGG - Intergenic
1040332846 8:46401106-46401128 GGGGGTTTCTGGGATGGGACAGG + Intergenic
1040334004 8:46406965-46406987 GGGGGTTTCTGGGATGGGAGAGG - Intergenic
1040335038 8:46411794-46411816 GGGGGCTTCAGGGATGGGAGAGG - Intergenic
1040340109 8:46436128-46436150 GGGGGCTTCTGGGATGGGACAGG + Intergenic
1040340410 8:46437642-46437664 GGGGGTTTCTGGGATGGGAGAGG + Intergenic
1040510111 8:48085699-48085721 GAGGGTTACAAGGATGCTGCTGG - Intergenic
1042017279 8:64327937-64327959 AAGGGTTTCAGAAATGAGGCGGG + Intergenic
1043463677 8:80485969-80485991 GGGGGTCTCAGGGAGGGGGCGGG - Intronic
1044441310 8:92227600-92227622 GAGTTTTCCAGGAATGGGGCAGG - Intergenic
1045661005 8:104437573-104437595 GAGTTTTTCAGGAAAGGGGCAGG - Intronic
1046069333 8:109231910-109231932 GAAAGTTTCAGGGATGAGGCGGG - Intergenic
1046193421 8:110829820-110829842 GAGGGTTTCTGGGTTAGGGGCGG + Intergenic
1047025371 8:120817834-120817856 GAGGTAACCAGGGATGGGGCGGG - Intergenic
1047804976 8:128349977-128349999 GAGGGTTCCAGAGACGGGGAAGG - Intergenic
1047900864 8:129421097-129421119 GAGAGTTCCAGGGAAGGGCCGGG + Intergenic
1048050328 8:130810288-130810310 AAGGGTGACAGGGAAGGGGCAGG - Intronic
1049151387 8:141037534-141037556 GAGGGTGACAGGGAAGCGGCTGG + Intergenic
1049201253 8:141341644-141341666 GAGGGTCTCGGGGCAGGGGCAGG + Intergenic
1049249059 8:141578465-141578487 GAGGGTCCCACAGATGGGGCTGG + Intergenic
1049249068 8:141578492-141578514 GAGGGTCCCACAGATGGGGCTGG + Intergenic
1049509753 8:143021614-143021636 GACGCCTTCTGGGATGGGGCAGG - Exonic
1049617695 8:143582874-143582896 CAGGGTTACAGGCATGGGTCTGG - Intronic
1049646879 8:143739510-143739532 GACAGTGTCAGGGGTGGGGCAGG + Intergenic
1049741187 8:144241765-144241787 GAGGGGTTCGCGGCTGGGGCAGG + Intronic
1050921186 9:11202813-11202835 GAGGGTATCAGGGCTGAGGGTGG - Intergenic
1052896579 9:33752667-33752689 GAAGGTTTCGGGGAGAGGGCTGG - Intronic
1053455356 9:38229317-38229339 GAGGGATGCAGGGTTGGGGCGGG + Intergenic
1053504430 9:38629576-38629598 GAGTGTATCAGGGATGGCGGTGG - Intergenic
1054453103 9:65413673-65413695 GAGGGGTACAGGGAGGTGGCAGG + Intergenic
1055878740 9:80973266-80973288 GAAGGTTTAAGGGAAGGGGTTGG + Intergenic
1057104325 9:92397273-92397295 GCTGATTTCAGGGTTGGGGCAGG - Intronic
1057723118 9:97548592-97548614 GATGGTGTGAGGGATGGGGAAGG + Intronic
1059157889 9:112005952-112005974 GAGGCCTTCATGGCTGGGGCAGG - Intergenic
1060103835 9:120861540-120861562 GAGGGCTTCAGGGAGGTGGTGGG + Intronic
1060444416 9:123674444-123674466 GAAGGTTTCAGCCCTGGGGCAGG + Intronic
1060785890 9:126451404-126451426 GAGGGTGTCAGGGACAGGTCAGG + Intronic
1060900035 9:127249028-127249050 GAGGATTTTTGGGCTGGGGCTGG + Intronic
1060942632 9:127551871-127551893 GAGAGTTTCAGGCAGAGGGCAGG - Intronic
1061494258 9:130962700-130962722 GAGGCTTCCTGGAATGGGGCAGG + Intergenic
1061670461 9:132185406-132185428 GAGGGTTTCAGTGCCGGGGTGGG - Intronic
1061706597 9:132457886-132457908 GAGGGTTTCAGGGAGGGAAAGGG - Intronic
1061935658 9:133856324-133856346 GAGGGTGGCAGGGCTGGGCCAGG + Intronic
1062180274 9:135187682-135187704 GAGGGTCTCAGGCAGGGGACTGG - Intergenic
1062220288 9:135411303-135411325 GAGGGTTTCCTGGATCGTGCCGG - Intergenic
1062432959 9:136534092-136534114 GAGGGCTTTTGGGATGTGGCGGG + Intronic
1062522469 9:136963987-136964009 GTGGGCTGCAGGGCTGGGGCTGG + Intergenic
1062533279 9:137010907-137010929 GATGGGTTCGGGGGTGGGGCAGG - Intronic
1062637265 9:137498269-137498291 TAGGGTTGGAGGGATGGGGCAGG - Intronic
1062652993 9:137587932-137587954 CAGGGTCTCAGGGACAGGGCTGG - Intronic
1062695472 9:137873653-137873675 GAGGGAGTGAGGGATGGGGGTGG + Intergenic
1185519410 X:727754-727776 GAGGGGTACTGGGCTGGGGCAGG + Intergenic
1185631269 X:1517411-1517433 GGGTGTTTGTGGGATGGGGCGGG - Intronic
1187188390 X:17009768-17009790 GAGGGTTTAAAGGATGAGGATGG - Intronic
1187764383 X:22623607-22623629 GTTGATTCCAGGGATGGGGCAGG + Intergenic
1187806269 X:23124725-23124747 GAAGGTTTGAGGGCAGGGGCAGG - Intergenic
1188089735 X:25949520-25949542 GATGGATTCAGGGAAGAGGCAGG + Intergenic
1189738673 X:44096840-44096862 GAGGGCTACAGTGGTGGGGCAGG - Intergenic
1191049041 X:56171514-56171536 GTGGGGTTCAGGGAGGGGGAGGG - Intergenic
1192224686 X:69220292-69220314 GAGGGTCCCTGGGATGGCGCTGG - Intergenic
1193010386 X:76669168-76669190 AAGTGTTTCAGGCATGGGGCTGG - Intergenic
1193471955 X:81916665-81916687 GTTGATTTTAGGGATGGGGCAGG + Intergenic
1195997287 X:110743908-110743930 GAGGTTTTCAGGGTTAGGGCTGG + Intronic
1198203629 X:134445800-134445822 AAGGGGTGCAGGGAGGGGGCGGG + Intergenic
1198780964 X:140235298-140235320 GTGGGGTTGGGGGATGGGGCAGG - Intergenic
1198960281 X:142175402-142175424 GAGGGTGTCAGGGACTGGGGAGG - Intergenic
1201490458 Y:14535649-14535671 GGGGGTTGGGGGGATGGGGCGGG + Intronic