ID: 968230358

View in Genome Browser
Species Human (GRCh38)
Location 3:197002111-197002133
Sequence CTACAGCCGGGGCGCTGCCA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 88}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968230340_968230358 25 Left 968230340 3:197002063-197002085 CCCCTCCCGGTGGGGTGAAGGTG 0: 1
1: 0
2: 1
3: 12
4: 108
Right 968230358 3:197002111-197002133 CTACAGCCGGGGCGCTGCCAGGG 0: 1
1: 0
2: 0
3: 4
4: 88
968230351_968230358 1 Left 968230351 3:197002087-197002109 CCGGGACTCCTCGGGGTTGCATG 0: 1
1: 0
2: 0
3: 4
4: 79
Right 968230358 3:197002111-197002133 CTACAGCCGGGGCGCTGCCAGGG 0: 1
1: 0
2: 0
3: 4
4: 88
968230350_968230358 2 Left 968230350 3:197002086-197002108 CCCGGGACTCCTCGGGGTTGCAT 0: 1
1: 0
2: 0
3: 4
4: 69
Right 968230358 3:197002111-197002133 CTACAGCCGGGGCGCTGCCAGGG 0: 1
1: 0
2: 0
3: 4
4: 88
968230345_968230358 19 Left 968230345 3:197002069-197002091 CCGGTGGGGTGAAGGTGCCCGGG 0: 1
1: 0
2: 0
3: 12
4: 154
Right 968230358 3:197002111-197002133 CTACAGCCGGGGCGCTGCCAGGG 0: 1
1: 0
2: 0
3: 4
4: 88
968230343_968230358 20 Left 968230343 3:197002068-197002090 CCCGGTGGGGTGAAGGTGCCCGG 0: 1
1: 0
2: 1
3: 19
4: 183
Right 968230358 3:197002111-197002133 CTACAGCCGGGGCGCTGCCAGGG 0: 1
1: 0
2: 0
3: 4
4: 88
968230353_968230358 -7 Left 968230353 3:197002095-197002117 CCTCGGGGTTGCATGGCTACAGC 0: 1
1: 0
2: 1
3: 5
4: 80
Right 968230358 3:197002111-197002133 CTACAGCCGGGGCGCTGCCAGGG 0: 1
1: 0
2: 0
3: 4
4: 88
968230342_968230358 23 Left 968230342 3:197002065-197002087 CCTCCCGGTGGGGTGAAGGTGCC 0: 1
1: 0
2: 1
3: 8
4: 96
Right 968230358 3:197002111-197002133 CTACAGCCGGGGCGCTGCCAGGG 0: 1
1: 0
2: 0
3: 4
4: 88
968230341_968230358 24 Left 968230341 3:197002064-197002086 CCCTCCCGGTGGGGTGAAGGTGC 0: 1
1: 0
2: 0
3: 7
4: 102
Right 968230358 3:197002111-197002133 CTACAGCCGGGGCGCTGCCAGGG 0: 1
1: 0
2: 0
3: 4
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968230358 Original CRISPR CTACAGCCGGGGCGCTGCCA GGG Exonic
901704633 1:11064073-11064095 CTAGAGCCTGGAGGCTGCCAGGG - Intergenic
902711444 1:18242828-18242850 CTGCAGCCAAGGCCCTGCCAAGG - Intronic
903817150 1:26072552-26072574 TTCCAGCCGGGGCGCTGGCAAGG + Intergenic
913701765 1:121381221-121381243 CTGCAGCCAGGCAGCTGCCAGGG + Intronic
914042325 1:144061690-144061712 CTGCAGCCAGGCAGCTGCCAGGG + Intergenic
914135764 1:144898798-144898820 CTGCAGCCAGGCAGCTGCCAGGG - Intronic
917800443 1:178564748-178564770 CTACAGACAGGGCCCTGCAAGGG - Intergenic
920375537 1:205505915-205505937 CTACAGCTGGGGAACTGCCGAGG - Intronic
920489189 1:206399941-206399963 CTGCAGCCAGGCAGCTGCCAGGG + Intronic
922725342 1:227920406-227920428 CTGCAGCCGGGGAGGTGGCAGGG + Exonic
1069716228 10:70523158-70523180 CTACAGCTGGTGCCCTGCAAGGG - Intronic
1072633816 10:97164745-97164767 CCACAGCCAGGGCCCTGCCCAGG + Intronic
1074393972 10:113081867-113081889 CTCCAGCCTGGGCGCAGCCTGGG - Intronic
1076852473 10:133099798-133099820 ACACAGCCAGGGGGCTGCCACGG + Intronic
1076985958 11:236284-236306 CCACAGCCGGAGGGCTGCCGCGG + Exonic
1077370880 11:2181114-2181136 GTACAGCCGAGACCCTGCCAGGG + Intergenic
1078161776 11:8846422-8846444 CTTCAGCCTGGGCGCTGCTTTGG - Intronic
1081673879 11:44957155-44957177 ATACAGCGGGGCCGCTGCCGAGG + Intergenic
1083276369 11:61599284-61599306 TCAGAGCCAGGGCGCTGCCAGGG - Intergenic
1083828066 11:65214169-65214191 CTCCATCCCGGGCGCGGCCACGG + Intergenic
1084208664 11:67610887-67610909 TTAGAGCAGGGGCTCTGCCATGG + Intronic
1089276093 11:117336923-117336945 CTGCAGCATGGGAGCTGCCATGG + Intronic
1096170177 12:49462373-49462395 CCACAGCCTGGATGCTGCCACGG - Intronic
1096372885 12:51083450-51083472 CGACGGCCGGGGAGCTCCCAGGG + Exonic
1102477003 12:113195265-113195287 CTGCAGCCCGGAAGCTGCCATGG - Intergenic
1103320005 12:120086970-120086992 CTACAGCCGCGGCGCAGCGCCGG - Intronic
1103886951 12:124209429-124209451 CTCCAGCCAGCGCTCTGCCACGG + Intronic
1104719708 12:131038539-131038561 CTACAGTCGGGGGGCAGACATGG + Intronic
1113437776 13:110306943-110306965 GCACAGCCGGGCCGCTGCGAAGG - Exonic
1121562352 14:94884834-94884856 CCAGGGCCTGGGCGCTGCCAGGG - Intergenic
1130319263 15:82826617-82826639 CTGCAGCCTGGGCGCAGCCTTGG + Intronic
1132291377 15:100706051-100706073 CTAGAGCCATGGCCCTGCCAGGG + Intergenic
1139475811 16:67202069-67202091 GTACAGCCGGGTCGGTGACAGGG + Exonic
1141429643 16:83965071-83965093 CAACAGCCGGGCCACTGCCGGGG + Exonic
1144656995 17:17043021-17043043 CGGCGGCCGGGGCGCCGCCAAGG + Intronic
1147866115 17:43553612-43553634 CTACAGCCTGGGGGCAGTCAGGG - Intronic
1150414509 17:64975996-64976018 GTACAGCCGCGGCGCTCCCTGGG + Intergenic
1153902551 18:9630811-9630833 CTGCAGCCAGGCAGCTGCCACGG + Intergenic
1157577632 18:48754330-48754352 CTACAGCAGAGGGCCTGCCAGGG - Intronic
1160673866 19:378322-378344 CTGCAGCCTGGGTGCTGCCTGGG - Intergenic
1160765720 19:806670-806692 CTGCAGCAGAGGGGCTGCCAGGG - Intronic
1161003492 19:1923100-1923122 GTACAGCCCGGGCGCTGCCGTGG + Exonic
1162433363 19:10642657-10642679 CTGCAGCCTGGACGCTGCCCTGG + Intronic
1167502448 19:49855643-49855665 CTGGACCCGGGGGGCTGCCAAGG + Intronic
1167503136 19:49858341-49858363 CTGCACCTGGGGGGCTGCCAAGG + Intronic
927679655 2:25131418-25131440 CAACAGCCGCAGCGCTGCGACGG + Exonic
927846397 2:26474542-26474564 CTCCAGCTGTGGCGTTGCCACGG + Exonic
936378321 2:111961863-111961885 CTGCAGCCGGGGCGCAGTCGTGG + Intronic
938370424 2:130764636-130764658 CTACAGATGGGGCTCAGCCATGG - Exonic
948197086 2:236104194-236104216 CAGCAGCCGGGGCGCTGGTAGGG + Intronic
948579020 2:238971583-238971605 CCACAGCTGGGAGGCTGCCAAGG + Intergenic
948645347 2:239400797-239400819 CGACAGCCGGGACGCGGCCACGG + Exonic
948738335 2:240025469-240025491 AGACAGCCAGTGCGCTGCCAGGG + Intergenic
1175916571 20:62428643-62428665 CACCAGCAGGGGCCCTGCCAGGG - Intergenic
1176454650 21:6898147-6898169 CACCAGCCGGGAAGCTGCCATGG + Intergenic
1176832823 21:13763195-13763217 CACCAGCCGGGAAGCTGCCATGG + Intergenic
1180615005 22:17121044-17121066 CTGCAGCCGGGCGGCTGCCGGGG + Exonic
1180988019 22:19917065-19917087 CGACAGCCAGGAAGCTGCCACGG + Intronic
1185155831 22:49192948-49192970 CCACAGCCTGGGCGAGGCCACGG - Intergenic
962876440 3:139539285-139539307 CTGCAGCCTGGGGGCTGCCCTGG + Intronic
967493783 3:190120997-190121019 CTGCAGCGGCGGGGCTGCCAGGG + Intronic
967562347 3:190931370-190931392 CTACAGCCGTGTTGCTGCAAAGG + Intergenic
968230358 3:197002111-197002133 CTACAGCCGGGGCGCTGCCAGGG + Exonic
968965344 4:3766556-3766578 CTGGAGCCGGGGCGCAGCCGCGG - Exonic
969244328 4:5922700-5922722 CTGCAGGCTGGGCACTGCCATGG - Intronic
979182410 4:117747377-117747399 CTACAGACGCAGCACTGCCAAGG + Intergenic
984734591 4:183098388-183098410 CTAGAGTCGGGGCGCGTCCACGG + Intergenic
985531677 5:437319-437341 CTTCAGCCTGGGCGCCGCCTGGG + Exonic
991628959 5:68634745-68634767 CTACAGCCAGGGGCCTGCCTGGG + Intergenic
1015480362 6:133701717-133701739 CCACAGCCGGGGCAGTGTCAGGG - Intergenic
1015965685 6:138693407-138693429 CCACCGCCCGGGGGCTGCCAAGG - Intergenic
1019562531 7:1665757-1665779 CTACAACCTCGGCGCTGCCGCGG + Intergenic
1022410638 7:30136113-30136135 CTCCAGCCGAGGCGGTGCCCTGG + Intronic
1034451051 7:151137491-151137513 CTCCAGCAGGGGCTCAGCCAGGG + Intronic
1041472400 8:58225354-58225376 CTACAGCCTTGCCACTGCCAAGG + Intergenic
1044752952 8:95433699-95433721 CTACAACAGGTGCACTGCCAGGG - Intergenic
1045094248 8:98781164-98781186 CTAAAGCCTGGGCGATGGCAGGG - Intronic
1049220729 8:141427676-141427698 CTTCAGCAGGTGCCCTGCCAAGG + Intronic
1049257303 8:141620797-141620819 CTACAGGAGAGGCCCTGCCAAGG - Intergenic
1049360762 8:142211618-142211640 CCACAGCCTGGGAGCAGCCAGGG + Intergenic
1053508786 9:38669318-38669340 CTGCAGCCGGGGCTCTGCTGTGG - Intergenic
1053562730 9:39212428-39212450 CTAGAGCCTGGTCACTGCCAGGG - Intronic
1053828532 9:42050401-42050423 CTAGAGCCTGGTCACTGCCAGGG - Intronic
1054134420 9:61406614-61406636 CTAGAGCCTGGTCACTGCCAGGG + Intergenic
1054602029 9:67137053-67137075 CTAGAGCCTGGTCACTGCCAGGG + Intergenic
1060483244 9:124030243-124030265 CTGCAGCCGGGGTGGTCCCAAGG + Intronic
1060798488 9:126528322-126528344 CCACACCCCGGACGCTGCCAGGG + Intergenic
1060877166 9:127091747-127091769 CTGCGGCTGGGGCGCTACCATGG - Exonic
1060895019 9:127211812-127211834 CTACAGCCTGGCCGCTCCCTGGG - Intronic
1061196101 9:129108124-129108146 CTACAGCTTTGGGGCTGCCAGGG - Intronic
1062093165 9:134689174-134689196 CTGCAGCCTCGGCACTGCCACGG - Intronic
1188005445 X:25013343-25013365 CCGCAGCCGGGGCGCTGCCCGGG + Exonic
1189014198 X:37078381-37078403 CTACAGCCGGGCGGTGGCCATGG + Intergenic