ID: 968230790

View in Genome Browser
Species Human (GRCh38)
Location 3:197003449-197003471
Sequence CCCGCCGCGTTCGTCCCCAG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 63
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 61}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968230790_968230793 -5 Left 968230790 3:197003449-197003471 CCGCTGGGGACGAACGCGGCGGG 0: 1
1: 0
2: 0
3: 1
4: 61
Right 968230793 3:197003467-197003489 GCGGGTCAGGCCCCGAAGCCCGG 0: 1
1: 0
2: 0
3: 13
4: 107
968230790_968230795 2 Left 968230790 3:197003449-197003471 CCGCTGGGGACGAACGCGGCGGG 0: 1
1: 0
2: 0
3: 1
4: 61
Right 968230795 3:197003474-197003496 AGGCCCCGAAGCCCGGGCCGCGG 0: 1
1: 0
2: 0
3: 18
4: 212
968230790_968230797 5 Left 968230790 3:197003449-197003471 CCGCTGGGGACGAACGCGGCGGG 0: 1
1: 0
2: 0
3: 1
4: 61
Right 968230797 3:197003477-197003499 CCCCGAAGCCCGGGCCGCGGTGG 0: 1
1: 0
2: 2
3: 32
4: 218
968230790_968230806 28 Left 968230790 3:197003449-197003471 CCGCTGGGGACGAACGCGGCGGG 0: 1
1: 0
2: 0
3: 1
4: 61
Right 968230806 3:197003500-197003522 CCGCCTCAGGCGCCCGCTCTGGG 0: 1
1: 0
2: 0
3: 8
4: 121
968230790_968230794 -4 Left 968230790 3:197003449-197003471 CCGCTGGGGACGAACGCGGCGGG 0: 1
1: 0
2: 0
3: 1
4: 61
Right 968230794 3:197003468-197003490 CGGGTCAGGCCCCGAAGCCCGGG 0: 1
1: 0
2: 2
3: 14
4: 133
968230790_968230804 27 Left 968230790 3:197003449-197003471 CCGCTGGGGACGAACGCGGCGGG 0: 1
1: 0
2: 0
3: 1
4: 61
Right 968230804 3:197003499-197003521 GCCGCCTCAGGCGCCCGCTCTGG 0: 1
1: 0
2: 0
3: 12
4: 152
968230790_968230807 29 Left 968230790 3:197003449-197003471 CCGCTGGGGACGAACGCGGCGGG 0: 1
1: 0
2: 0
3: 1
4: 61
Right 968230807 3:197003501-197003523 CGCCTCAGGCGCCCGCTCTGGGG 0: 1
1: 0
2: 1
3: 7
4: 139
968230790_968230802 15 Left 968230790 3:197003449-197003471 CCGCTGGGGACGAACGCGGCGGG 0: 1
1: 0
2: 0
3: 1
4: 61
Right 968230802 3:197003487-197003509 CGGGCCGCGGTGGCCGCCTCAGG 0: 1
1: 0
2: 0
3: 12
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968230790 Original CRISPR CCCGCCGCGTTCGTCCCCAG CGG (reversed) Exonic