ID: 968230798

View in Genome Browser
Species Human (GRCh38)
Location 3:197003478-197003500
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 173}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968230798_968230820 23 Left 968230798 3:197003478-197003500 CCCGAAGCCCGGGCCGCGGTGGC 0: 1
1: 0
2: 0
3: 11
4: 173
Right 968230820 3:197003524-197003546 TGGGGGTGGGGGCATCTTTCGGG 0: 1
1: 0
2: 5
3: 50
4: 333
968230798_968230814 10 Left 968230798 3:197003478-197003500 CCCGAAGCCCGGGCCGCGGTGGC 0: 1
1: 0
2: 0
3: 11
4: 173
Right 968230814 3:197003511-197003533 GCCCGCTCTGGGGTGGGGGTGGG 0: 1
1: 0
2: 8
3: 255
4: 3656
968230798_968230813 9 Left 968230798 3:197003478-197003500 CCCGAAGCCCGGGCCGCGGTGGC 0: 1
1: 0
2: 0
3: 11
4: 173
Right 968230813 3:197003510-197003532 CGCCCGCTCTGGGGTGGGGGTGG 0: 1
1: 0
2: 5
3: 43
4: 618
968230798_968230809 3 Left 968230798 3:197003478-197003500 CCCGAAGCCCGGGCCGCGGTGGC 0: 1
1: 0
2: 0
3: 11
4: 173
Right 968230809 3:197003504-197003526 CTCAGGCGCCCGCTCTGGGGTGG 0: 1
1: 0
2: 1
3: 12
4: 169
968230798_968230818 12 Left 968230798 3:197003478-197003500 CCCGAAGCCCGGGCCGCGGTGGC 0: 1
1: 0
2: 0
3: 11
4: 173
Right 968230818 3:197003513-197003535 CCGCTCTGGGGTGGGGGTGGGGG 0: 1
1: 1
2: 21
3: 276
4: 2291
968230798_968230816 11 Left 968230798 3:197003478-197003500 CCCGAAGCCCGGGCCGCGGTGGC 0: 1
1: 0
2: 0
3: 11
4: 173
Right 968230816 3:197003512-197003534 CCCGCTCTGGGGTGGGGGTGGGG 0: 1
1: 0
2: 11
3: 141
4: 1416
968230798_968230807 0 Left 968230798 3:197003478-197003500 CCCGAAGCCCGGGCCGCGGTGGC 0: 1
1: 0
2: 0
3: 11
4: 173
Right 968230807 3:197003501-197003523 CGCCTCAGGCGCCCGCTCTGGGG 0: 1
1: 0
2: 1
3: 7
4: 139
968230798_968230812 6 Left 968230798 3:197003478-197003500 CCCGAAGCCCGGGCCGCGGTGGC 0: 1
1: 0
2: 0
3: 11
4: 173
Right 968230812 3:197003507-197003529 AGGCGCCCGCTCTGGGGTGGGGG 0: 1
1: 0
2: 0
3: 8
4: 387
968230798_968230804 -2 Left 968230798 3:197003478-197003500 CCCGAAGCCCGGGCCGCGGTGGC 0: 1
1: 0
2: 0
3: 11
4: 173
Right 968230804 3:197003499-197003521 GCCGCCTCAGGCGCCCGCTCTGG 0: 1
1: 0
2: 0
3: 12
4: 152
968230798_968230819 22 Left 968230798 3:197003478-197003500 CCCGAAGCCCGGGCCGCGGTGGC 0: 1
1: 0
2: 0
3: 11
4: 173
Right 968230819 3:197003523-197003545 GTGGGGGTGGGGGCATCTTTCGG 0: 1
1: 0
2: 5
3: 46
4: 442
968230798_968230811 5 Left 968230798 3:197003478-197003500 CCCGAAGCCCGGGCCGCGGTGGC 0: 1
1: 0
2: 0
3: 11
4: 173
Right 968230811 3:197003506-197003528 CAGGCGCCCGCTCTGGGGTGGGG 0: 1
1: 0
2: 1
3: 15
4: 384
968230798_968230810 4 Left 968230798 3:197003478-197003500 CCCGAAGCCCGGGCCGCGGTGGC 0: 1
1: 0
2: 0
3: 11
4: 173
Right 968230810 3:197003505-197003527 TCAGGCGCCCGCTCTGGGGTGGG 0: 1
1: 0
2: 1
3: 5
4: 129
968230798_968230806 -1 Left 968230798 3:197003478-197003500 CCCGAAGCCCGGGCCGCGGTGGC 0: 1
1: 0
2: 0
3: 11
4: 173
Right 968230806 3:197003500-197003522 CCGCCTCAGGCGCCCGCTCTGGG 0: 1
1: 0
2: 0
3: 8
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968230798 Original CRISPR GCCACCGCGGCCCGGGCTTC GGG (reversed) Intronic