ID: 968230804

View in Genome Browser
Species Human (GRCh38)
Location 3:197003499-197003521
Sequence GCCGCCTCAGGCGCCCGCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 152}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968230790_968230804 27 Left 968230790 3:197003449-197003471 CCGCTGGGGACGAACGCGGCGGG 0: 1
1: 0
2: 0
3: 1
4: 61
Right 968230804 3:197003499-197003521 GCCGCCTCAGGCGCCCGCTCTGG 0: 1
1: 0
2: 0
3: 12
4: 152
968230801_968230804 -10 Left 968230801 3:197003486-197003508 CCGGGCCGCGGTGGCCGCCTCAG 0: 1
1: 0
2: 1
3: 22
4: 210
Right 968230804 3:197003499-197003521 GCCGCCTCAGGCGCCCGCTCTGG 0: 1
1: 0
2: 0
3: 12
4: 152
968230798_968230804 -2 Left 968230798 3:197003478-197003500 CCCGAAGCCCGGGCCGCGGTGGC 0: 1
1: 0
2: 0
3: 11
4: 173
Right 968230804 3:197003499-197003521 GCCGCCTCAGGCGCCCGCTCTGG 0: 1
1: 0
2: 0
3: 12
4: 152
968230796_968230804 -1 Left 968230796 3:197003477-197003499 CCCCGAAGCCCGGGCCGCGGTGG 0: 1
1: 0
2: 1
3: 11
4: 126
Right 968230804 3:197003499-197003521 GCCGCCTCAGGCGCCCGCTCTGG 0: 1
1: 0
2: 0
3: 12
4: 152
968230799_968230804 -3 Left 968230799 3:197003479-197003501 CCGAAGCCCGGGCCGCGGTGGCC 0: 1
1: 0
2: 2
3: 16
4: 178
Right 968230804 3:197003499-197003521 GCCGCCTCAGGCGCCCGCTCTGG 0: 1
1: 0
2: 0
3: 12
4: 152
968230800_968230804 -9 Left 968230800 3:197003485-197003507 CCCGGGCCGCGGTGGCCGCCTCA 0: 1
1: 0
2: 3
3: 22
4: 222
Right 968230804 3:197003499-197003521 GCCGCCTCAGGCGCCCGCTCTGG 0: 1
1: 0
2: 0
3: 12
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968230804 Original CRISPR GCCGCCTCAGGCGCCCGCTC TGG Intronic