ID: 968230807

View in Genome Browser
Species Human (GRCh38)
Location 3:197003501-197003523
Sequence CGCCTCAGGCGCCCGCTCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 139}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968230801_968230807 -8 Left 968230801 3:197003486-197003508 CCGGGCCGCGGTGGCCGCCTCAG 0: 1
1: 0
2: 1
3: 22
4: 210
Right 968230807 3:197003501-197003523 CGCCTCAGGCGCCCGCTCTGGGG 0: 1
1: 0
2: 1
3: 7
4: 139
968230800_968230807 -7 Left 968230800 3:197003485-197003507 CCCGGGCCGCGGTGGCCGCCTCA 0: 1
1: 0
2: 3
3: 22
4: 222
Right 968230807 3:197003501-197003523 CGCCTCAGGCGCCCGCTCTGGGG 0: 1
1: 0
2: 1
3: 7
4: 139
968230790_968230807 29 Left 968230790 3:197003449-197003471 CCGCTGGGGACGAACGCGGCGGG 0: 1
1: 0
2: 0
3: 1
4: 61
Right 968230807 3:197003501-197003523 CGCCTCAGGCGCCCGCTCTGGGG 0: 1
1: 0
2: 1
3: 7
4: 139
968230798_968230807 0 Left 968230798 3:197003478-197003500 CCCGAAGCCCGGGCCGCGGTGGC 0: 1
1: 0
2: 0
3: 11
4: 173
Right 968230807 3:197003501-197003523 CGCCTCAGGCGCCCGCTCTGGGG 0: 1
1: 0
2: 1
3: 7
4: 139
968230796_968230807 1 Left 968230796 3:197003477-197003499 CCCCGAAGCCCGGGCCGCGGTGG 0: 1
1: 0
2: 1
3: 11
4: 126
Right 968230807 3:197003501-197003523 CGCCTCAGGCGCCCGCTCTGGGG 0: 1
1: 0
2: 1
3: 7
4: 139
968230799_968230807 -1 Left 968230799 3:197003479-197003501 CCGAAGCCCGGGCCGCGGTGGCC 0: 1
1: 0
2: 2
3: 16
4: 178
Right 968230807 3:197003501-197003523 CGCCTCAGGCGCCCGCTCTGGGG 0: 1
1: 0
2: 1
3: 7
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968230807 Original CRISPR CGCCTCAGGCGCCCGCTCTG GGG Intronic