ID: 968230813

View in Genome Browser
Species Human (GRCh38)
Location 3:197003510-197003532
Sequence CGCCCGCTCTGGGGTGGGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 667
Summary {0: 1, 1: 0, 2: 5, 3: 43, 4: 618}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968230799_968230813 8 Left 968230799 3:197003479-197003501 CCGAAGCCCGGGCCGCGGTGGCC 0: 1
1: 0
2: 2
3: 16
4: 178
Right 968230813 3:197003510-197003532 CGCCCGCTCTGGGGTGGGGGTGG 0: 1
1: 0
2: 5
3: 43
4: 618
968230803_968230813 -4 Left 968230803 3:197003491-197003513 CCGCGGTGGCCGCCTCAGGCGCC 0: 1
1: 0
2: 0
3: 28
4: 174
Right 968230813 3:197003510-197003532 CGCCCGCTCTGGGGTGGGGGTGG 0: 1
1: 0
2: 5
3: 43
4: 618
968230800_968230813 2 Left 968230800 3:197003485-197003507 CCCGGGCCGCGGTGGCCGCCTCA 0: 1
1: 0
2: 3
3: 22
4: 222
Right 968230813 3:197003510-197003532 CGCCCGCTCTGGGGTGGGGGTGG 0: 1
1: 0
2: 5
3: 43
4: 618
968230796_968230813 10 Left 968230796 3:197003477-197003499 CCCCGAAGCCCGGGCCGCGGTGG 0: 1
1: 0
2: 1
3: 11
4: 126
Right 968230813 3:197003510-197003532 CGCCCGCTCTGGGGTGGGGGTGG 0: 1
1: 0
2: 5
3: 43
4: 618
968230798_968230813 9 Left 968230798 3:197003478-197003500 CCCGAAGCCCGGGCCGCGGTGGC 0: 1
1: 0
2: 0
3: 11
4: 173
Right 968230813 3:197003510-197003532 CGCCCGCTCTGGGGTGGGGGTGG 0: 1
1: 0
2: 5
3: 43
4: 618
968230801_968230813 1 Left 968230801 3:197003486-197003508 CCGGGCCGCGGTGGCCGCCTCAG 0: 1
1: 0
2: 1
3: 22
4: 210
Right 968230813 3:197003510-197003532 CGCCCGCTCTGGGGTGGGGGTGG 0: 1
1: 0
2: 5
3: 43
4: 618

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968230813 Original CRISPR CGCCCGCTCTGGGGTGGGGG TGG Intronic