ID: 968230818

View in Genome Browser
Species Human (GRCh38)
Location 3:197003513-197003535
Sequence CCGCTCTGGGGTGGGGGTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2590
Summary {0: 1, 1: 1, 2: 21, 3: 276, 4: 2291}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968230798_968230818 12 Left 968230798 3:197003478-197003500 CCCGAAGCCCGGGCCGCGGTGGC 0: 1
1: 0
2: 0
3: 11
4: 173
Right 968230818 3:197003513-197003535 CCGCTCTGGGGTGGGGGTGGGGG 0: 1
1: 1
2: 21
3: 276
4: 2291
968230799_968230818 11 Left 968230799 3:197003479-197003501 CCGAAGCCCGGGCCGCGGTGGCC 0: 1
1: 0
2: 2
3: 16
4: 178
Right 968230818 3:197003513-197003535 CCGCTCTGGGGTGGGGGTGGGGG 0: 1
1: 1
2: 21
3: 276
4: 2291
968230801_968230818 4 Left 968230801 3:197003486-197003508 CCGGGCCGCGGTGGCCGCCTCAG 0: 1
1: 0
2: 1
3: 22
4: 210
Right 968230818 3:197003513-197003535 CCGCTCTGGGGTGGGGGTGGGGG 0: 1
1: 1
2: 21
3: 276
4: 2291
968230800_968230818 5 Left 968230800 3:197003485-197003507 CCCGGGCCGCGGTGGCCGCCTCA 0: 1
1: 0
2: 3
3: 22
4: 222
Right 968230818 3:197003513-197003535 CCGCTCTGGGGTGGGGGTGGGGG 0: 1
1: 1
2: 21
3: 276
4: 2291
968230796_968230818 13 Left 968230796 3:197003477-197003499 CCCCGAAGCCCGGGCCGCGGTGG 0: 1
1: 0
2: 1
3: 11
4: 126
Right 968230818 3:197003513-197003535 CCGCTCTGGGGTGGGGGTGGGGG 0: 1
1: 1
2: 21
3: 276
4: 2291
968230805_968230818 -10 Left 968230805 3:197003500-197003522 CCGCCTCAGGCGCCCGCTCTGGG 0: 1
1: 0
2: 0
3: 14
4: 204
Right 968230818 3:197003513-197003535 CCGCTCTGGGGTGGGGGTGGGGG 0: 1
1: 1
2: 21
3: 276
4: 2291
968230803_968230818 -1 Left 968230803 3:197003491-197003513 CCGCGGTGGCCGCCTCAGGCGCC 0: 1
1: 0
2: 0
3: 28
4: 174
Right 968230818 3:197003513-197003535 CCGCTCTGGGGTGGGGGTGGGGG 0: 1
1: 1
2: 21
3: 276
4: 2291

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968230818 Original CRISPR CCGCTCTGGGGTGGGGGTGG GGG Intronic