ID: 968230819

View in Genome Browser
Species Human (GRCh38)
Location 3:197003523-197003545
Sequence GTGGGGGTGGGGGCATCTTT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 494
Summary {0: 1, 1: 0, 2: 5, 3: 46, 4: 442}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968230808_968230819 -3 Left 968230808 3:197003503-197003525 CCTCAGGCGCCCGCTCTGGGGTG 0: 1
1: 0
2: 1
3: 9
4: 153
Right 968230819 3:197003523-197003545 GTGGGGGTGGGGGCATCTTTCGG 0: 1
1: 0
2: 5
3: 46
4: 442
968230801_968230819 14 Left 968230801 3:197003486-197003508 CCGGGCCGCGGTGGCCGCCTCAG 0: 1
1: 0
2: 1
3: 22
4: 210
Right 968230819 3:197003523-197003545 GTGGGGGTGGGGGCATCTTTCGG 0: 1
1: 0
2: 5
3: 46
4: 442
968230803_968230819 9 Left 968230803 3:197003491-197003513 CCGCGGTGGCCGCCTCAGGCGCC 0: 1
1: 0
2: 0
3: 28
4: 174
Right 968230819 3:197003523-197003545 GTGGGGGTGGGGGCATCTTTCGG 0: 1
1: 0
2: 5
3: 46
4: 442
968230799_968230819 21 Left 968230799 3:197003479-197003501 CCGAAGCCCGGGCCGCGGTGGCC 0: 1
1: 0
2: 2
3: 16
4: 178
Right 968230819 3:197003523-197003545 GTGGGGGTGGGGGCATCTTTCGG 0: 1
1: 0
2: 5
3: 46
4: 442
968230798_968230819 22 Left 968230798 3:197003478-197003500 CCCGAAGCCCGGGCCGCGGTGGC 0: 1
1: 0
2: 0
3: 11
4: 173
Right 968230819 3:197003523-197003545 GTGGGGGTGGGGGCATCTTTCGG 0: 1
1: 0
2: 5
3: 46
4: 442
968230796_968230819 23 Left 968230796 3:197003477-197003499 CCCCGAAGCCCGGGCCGCGGTGG 0: 1
1: 0
2: 1
3: 11
4: 126
Right 968230819 3:197003523-197003545 GTGGGGGTGGGGGCATCTTTCGG 0: 1
1: 0
2: 5
3: 46
4: 442
968230800_968230819 15 Left 968230800 3:197003485-197003507 CCCGGGCCGCGGTGGCCGCCTCA 0: 1
1: 0
2: 3
3: 22
4: 222
Right 968230819 3:197003523-197003545 GTGGGGGTGGGGGCATCTTTCGG 0: 1
1: 0
2: 5
3: 46
4: 442
968230805_968230819 0 Left 968230805 3:197003500-197003522 CCGCCTCAGGCGCCCGCTCTGGG 0: 1
1: 0
2: 0
3: 14
4: 204
Right 968230819 3:197003523-197003545 GTGGGGGTGGGGGCATCTTTCGG 0: 1
1: 0
2: 5
3: 46
4: 442

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968230819 Original CRISPR GTGGGGGTGGGGGCATCTTT CGG Intronic