ID: 968233084

View in Genome Browser
Species Human (GRCh38)
Location 3:197015707-197015729
Sequence CGTGCATGTAACTCAGTGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 102}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968233077_968233084 27 Left 968233077 3:197015657-197015679 CCTCACACAGAAAAGGGGCAACT 0: 1
1: 0
2: 1
3: 14
4: 172
Right 968233084 3:197015707-197015729 CGTGCATGTAACTCAGTGTGTGG 0: 1
1: 0
2: 0
3: 3
4: 102
968233082_968233084 -2 Left 968233082 3:197015686-197015708 CCTGAGGAAGACCATGGCTGGCG 0: 1
1: 0
2: 0
3: 16
4: 102
Right 968233084 3:197015707-197015729 CGTGCATGTAACTCAGTGTGTGG 0: 1
1: 0
2: 0
3: 3
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968233084 Original CRISPR CGTGCATGTAACTCAGTGTG TGG Intronic