ID: 968234265

View in Genome Browser
Species Human (GRCh38)
Location 3:197022544-197022566
Sequence AGTCTCCTGCATCCACGGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 121}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968234262_968234265 -9 Left 968234262 3:197022530-197022552 CCACGAGCTGTTAGAGTCTCCTG 0: 1
1: 0
2: 0
3: 5
4: 76
Right 968234265 3:197022544-197022566 AGTCTCCTGCATCCACGGAAGGG 0: 1
1: 0
2: 0
3: 6
4: 121
968234259_968234265 18 Left 968234259 3:197022503-197022525 CCTCCTCTGCAGGCAGATGGAAT 0: 1
1: 0
2: 0
3: 24
4: 246
Right 968234265 3:197022544-197022566 AGTCTCCTGCATCCACGGAAGGG 0: 1
1: 0
2: 0
3: 6
4: 121
968234260_968234265 15 Left 968234260 3:197022506-197022528 CCTCTGCAGGCAGATGGAATTGG 0: 1
1: 0
2: 1
3: 21
4: 232
Right 968234265 3:197022544-197022566 AGTCTCCTGCATCCACGGAAGGG 0: 1
1: 0
2: 0
3: 6
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968234265 Original CRISPR AGTCTCCTGCATCCACGGAA GGG Intronic
901496935 1:9627695-9627717 AGTCTCCTGCACAAAGGGAAGGG + Intergenic
904804513 1:33121178-33121200 AGTCCCCTGCAGCCACTGAGGGG - Intergenic
908338285 1:63149587-63149609 AGCCTCCTTCATTCACAGAAAGG + Intergenic
909834306 1:80233914-80233936 ATTCTCCTGAATCCACTGAGGGG - Intergenic
913986665 1:143572077-143572099 AGTCTCTTGTATCCACTAAAAGG + Intergenic
914342995 1:146776230-146776252 ACTCTCCTGCATCCCTCGAAAGG + Intergenic
914370511 1:147020379-147020401 AGTCTCTAGTATCCACTGAAAGG - Intergenic
914484183 1:148093031-148093053 AGTCTCTAGTATCCACTGAAAGG + Intergenic
918239215 1:182606999-182607021 AGACTTCTGCCTCCATGGAAAGG - Intergenic
919168994 1:193930313-193930335 TGTCTCCTGGATCCTCGGAAAGG - Intergenic
919641349 1:200047914-200047936 ACTCTCCTCCATCCACAAAAGGG + Intronic
920054871 1:203184492-203184514 GGTCTCCCGCATCCACTGTATGG - Intronic
920108620 1:203571817-203571839 AGTCTCCTGCTTTCTAGGAATGG + Intergenic
920986235 1:210892259-210892281 AGTTTCAGGCATCCAGGGAATGG - Intronic
923076122 1:230610270-230610292 GGTCTCCTGCATCCAAGGCCAGG - Intergenic
1069936225 10:71919090-71919112 GGTCTCCACCATCCAGGGAATGG - Intergenic
1072777391 10:98212561-98212583 AGTCTCCTAAAGCCACGGTATGG + Intronic
1073150357 10:101307171-101307193 ATTCTCCTGCCTCCAGGCAAGGG - Intergenic
1082147901 11:48693354-48693376 AGACTGCTGAATCCACAGAAAGG - Intergenic
1082149003 11:48708658-48708680 AATCTTCTGAATCCACAGAAAGG + Intergenic
1082592556 11:55030921-55030943 AAACTGCTGCATCCACAGAAAGG + Intergenic
1082594946 11:55066434-55066456 AAACTGCTGCATCCACAGAAAGG + Intergenic
1083595214 11:63915765-63915787 AGTTACCTGCAGCCACAGAAGGG + Intronic
1084973697 11:72785018-72785040 AGACTCCTGCAACCGGGGAAGGG + Intronic
1085156325 11:74298308-74298330 AGCCTCCTCCAGCCATGGAATGG + Exonic
1094855929 12:34402837-34402859 AGGCTCTTTCATCCACGGAGGGG - Intergenic
1104413825 12:128581387-128581409 AGACTCCTGCTTCCACCGGAGGG + Intronic
1110800852 13:79692939-79692961 CTTCTCCTGCATCCAAGGAAAGG - Intergenic
1113222682 13:108123098-108123120 ACCCTCCTGCATCCAGGGAATGG - Intergenic
1117025495 14:51615942-51615964 AGTCTCCTGCATCTTTAGAAAGG - Intronic
1121690198 14:95872733-95872755 AATCTCCTAGATCCAAGGAAGGG + Intergenic
1121829003 14:97033755-97033777 ACTCTGCTGCAGCCCCGGAACGG + Intergenic
1123067326 14:105625269-105625291 AGTAGCCTGCATCCAGGGACAGG - Intergenic
1123091005 14:105742266-105742288 AGTAGCCTGCATCCAGGGACAGG - Intergenic
1123096639 14:105770030-105770052 AGTGGCCTGCATCCAGGGACAGG - Intergenic
1202883389 14_KI270722v1_random:82397-82419 ACTCTCCTGCACCCACGGTCTGG + Intergenic
1130143604 15:81254374-81254396 ATTCTCATGCAACCAAGGAATGG - Intronic
1131274439 15:90969191-90969213 TGCCTCCTGCAGCCAGGGAATGG + Intronic
1133629958 16:7610769-7610791 AGGCACCTGCATCTATGGAATGG + Intronic
1133731647 16:8583421-8583443 AGTCACCTGCATCCACAAATGGG - Intronic
1137327797 16:47459883-47459905 AGGTTCCTGCATCCCCGCAAGGG + Intronic
1139990990 16:70939098-70939120 ACTCTCCTGCATCCCTCGAAAGG - Intronic
1141389107 16:83649644-83649666 AGCCTCCTGCAGCCAGGGGAAGG + Intronic
1143579699 17:7818295-7818317 GACCACCTGCATCCACGGAAGGG - Exonic
1145023878 17:19453270-19453292 AGCCTCCTGCCCCCAAGGAAGGG + Intergenic
1147310519 17:39593414-39593436 AGACTCCTGTGTCCAGGGAAGGG + Intergenic
1147427664 17:40353805-40353827 CACCTCCTGCATCCACGGCATGG - Intronic
1149806177 17:59619994-59620016 AGTTTCCTGCGTCCCCGGAGAGG + Exonic
1149943788 17:60899298-60899320 AGGCTCCTGCAGCCAGGGATGGG - Intronic
1150236888 17:63600798-63600820 AGTACCGTGCAGCCACGGAACGG + Intergenic
1150294618 17:64001283-64001305 ACTGTCCTGCCTCCAGGGAAAGG + Exonic
1151225944 17:72648542-72648564 AGTCTACTGCATCAAGGGACGGG + Intronic
1152368127 17:79869242-79869264 ATTCTCTTGCATCCAAGCAAAGG - Intergenic
1165269208 19:34690297-34690319 AGCCTCCTGCATCCACTGGGTGG + Intergenic
1168114924 19:54217141-54217163 AGCCTCCTCCATCCCAGGAAGGG - Exonic
1168120615 19:54250834-54250856 AGCCTCCTCCATCCCAGGAAAGG - Exonic
1168124193 19:54274731-54274753 AGCCTCCTCCATCCCAGGAAAGG - Exonic
1168177795 19:54636808-54636830 AGCCTCCTCCATCCCAGGAAGGG + Exonic
1168182065 19:54667949-54667971 AGCCTCCTCCATCCCAGGAAGGG + Exonic
1168431744 19:56287071-56287093 AGACTCCAGAATCCATGGAATGG - Intronic
1202658800 1_KI270708v1_random:49541-49563 ACTCTCCTGCACCCACGGTCTGG + Intergenic
926606704 2:14905460-14905482 AGTCTCCCGCAGCCACCGAGCGG - Intergenic
933616533 2:84487554-84487576 TGTCTCCTCCATCCAGGGACTGG - Intergenic
934660272 2:96139412-96139434 AGTCACCTGCACCCAGTGAAGGG + Intergenic
937917805 2:127107398-127107420 AATCTCCTGCAACCCAGGAAAGG + Intergenic
938800783 2:134761499-134761521 AGCCTCCAGAATCCACAGAAAGG + Intergenic
939057338 2:137381238-137381260 AGTCCCCTGCAAGCAGGGAAAGG + Intronic
942501808 2:176599039-176599061 AGACCCTTTCATCCACGGAATGG - Intergenic
946053402 2:216881988-216882010 AGTTCCCTGAATCCATGGAAGGG - Intergenic
946359905 2:219213056-219213078 AGTCTCCCGCCTGCAAGGAAAGG + Exonic
948079660 2:235195484-235195506 AGTCTCCCCCTGCCACGGAAGGG + Intergenic
1171426069 20:25049499-25049521 TGTCTCCTGCACCCATGGCAGGG - Intronic
1172093830 20:32451080-32451102 GGTCTCCTGCAGCCAAGGATGGG + Intronic
1172909272 20:38394518-38394540 AGCCTCATGCATCCCTGGAATGG - Intergenic
1173841858 20:46162679-46162701 AGTCTCCTGCATCCAAGCCCGGG + Intergenic
1178672440 21:34603698-34603720 AGTCTCCTTCATCTATGAAATGG + Intronic
1178920102 21:36733085-36733107 ATTCTCCTGCCTCCATGGAAGGG - Intronic
1180326268 22:11433060-11433082 ACTCTCCTGCACCCACGGTCTGG + Intergenic
1182520760 22:30883350-30883372 AGTCCCCTGCATCCCGGGACTGG - Intronic
1183428319 22:37751293-37751315 AGTCTCCTGGAGCCGAGGAAAGG + Intronic
1185005505 22:48274238-48274260 ACTCTGCTGCATACACTGAAGGG - Intergenic
949418300 3:3836994-3837016 TGTCTCCTGCACCCATGGGAAGG + Intronic
950417474 3:12876525-12876547 AATCTGCTGCAACCAGGGAAGGG + Intergenic
952744059 3:36761657-36761679 ACCCTCCTGGATCCAAGGAAAGG + Intergenic
954657592 3:52205749-52205771 AGTCTCCTGGATCCTAGAAAGGG + Intronic
955866680 3:63391393-63391415 AGATTCCTTCATCCAGGGAAAGG - Intronic
964476230 3:157100266-157100288 AGTCCCCTGTATCTACTGAAAGG + Intergenic
965785258 3:172328548-172328570 AGTCTACTGCATCCACAGAGGGG - Intronic
968234265 3:197022544-197022566 AGTCTCCTGCATCCACGGAAGGG + Intronic
983073004 4:163291950-163291972 AGTTTCCTTTATCCAGGGAAAGG + Intergenic
988954899 5:36305689-36305711 AGTCTCTTGAATCCACGGACAGG - Intergenic
989852790 5:46236504-46236526 AATCTCCTGAATCCATAGAAAGG + Intergenic
990107138 5:52278551-52278573 AGTCTCTTGAATCCAGGAAACGG + Intergenic
994061687 5:95485945-95485967 AGGCTCCTGAATGCAGGGAAAGG + Intronic
997251173 5:132389765-132389787 AGTCACCCGCTTCCAAGGAATGG + Intronic
997310255 5:132873857-132873879 AGTCTACAGCATCTGCGGAATGG + Intronic
999108225 5:149092910-149092932 AGACTCCTGCATCCTCTGCATGG + Intergenic
1000642731 5:163722054-163722076 TGTCTCCTGCATCCAAGCAGAGG - Intergenic
1007155941 6:39743785-39743807 AATCTCCTGCTTCCAGGAAAAGG - Intergenic
1008036589 6:46751987-46752009 AGTCTCCTGCAGCCACAGCTTGG - Exonic
1010144193 6:72647223-72647245 AGTCACCTGCCTACACGGCAAGG - Intronic
1017877626 6:158537150-158537172 AGGCTCCCGCCTCCCCGGAAAGG + Intronic
1019179653 6:170178313-170178335 TTTCTCCTGCATCCAGTGAAGGG - Intergenic
1021139872 7:17010968-17010990 AGTCCCCTGCTTCAAGGGAATGG + Intergenic
1022592618 7:31680323-31680345 ATTCTCCTGCATCAATGAAACGG - Intergenic
1023588351 7:41754427-41754449 TGTCTCTTGCATTCAGGGAAGGG + Intergenic
1025586426 7:62794719-62794741 AAACTGCTGCATCCACAGAAAGG - Intergenic
1028220331 7:88189465-88189487 AGTTTCCTCCATCTACAGAAAGG - Intronic
1031016815 7:116584537-116584559 AAACTCCTGCATCCACTGACAGG + Intergenic
1032918771 7:136522242-136522264 AGTTTCAGGCATCCACTGAAGGG - Intergenic
1035704721 8:1666869-1666891 AGTGTCCTGCAGACACAGAAAGG + Intronic
1036699086 8:10999771-10999793 AGTCACCTGCATCAACCCAACGG - Intronic
1037330268 8:17737119-17737141 AGACTTCTGCATGCACGTAAAGG + Intronic
1040133849 8:43829422-43829444 AATCTCCTGAATCAAAGGAAAGG - Intergenic
1044271846 8:90253620-90253642 GGTCTCCTGCTTCTATGGAAGGG + Intergenic
1048177001 8:132161957-132161979 AGTCTCCTTCATCCAGGGTTGGG - Intronic
1049276573 8:141723050-141723072 TGTCACCTTCATCCACGGCAGGG + Intergenic
1053717955 9:40915909-40915931 ACTCTCCTGCACCCACTGTAGGG - Intergenic
1058635724 9:107036591-107036613 TGTCTCCAGAATCCAGGGAAAGG - Intergenic
1058967139 9:110048761-110048783 AGTCTCCTGGACCCCCGGAGCGG + Exonic
1060533580 9:124364684-124364706 AAACTCCTGGAGCCACGGAAAGG + Intronic
1062316279 9:135968635-135968657 ACTCTCCAGCAGCCCCGGAAAGG + Intergenic
1062544204 9:137054326-137054348 GGTCTCCTGCCTCCACGGCCGGG - Intergenic
1188559504 X:31451570-31451592 AGTCTCCTGCAGGCCCGGCACGG - Intronic
1189332766 X:40153510-40153532 CCTTTCCTGCATCCAAGGAAGGG + Intronic
1190073945 X:47301808-47301830 TCTCTCCTGGATCCAGGGAAAGG + Intergenic
1197062223 X:122195300-122195322 AGTCTCCTGCAACAAGGGAGAGG - Intergenic
1198068564 X:133124884-133124906 TCTCTCCTGGATCCAGGGAAAGG + Intergenic