ID: 968241632

View in Genome Browser
Species Human (GRCh38)
Location 3:197093843-197093865
Sequence CTGTCGATGGGGAAATTGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 104}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968241632_968241638 2 Left 968241632 3:197093843-197093865 CCTTGCAATTTCCCCATCGACAG 0: 1
1: 0
2: 2
3: 13
4: 104
Right 968241638 3:197093868-197093890 GGAATCTAATTCCCCTCTCCTGG 0: 1
1: 0
2: 2
3: 27
4: 144
968241632_968241639 9 Left 968241632 3:197093843-197093865 CCTTGCAATTTCCCCATCGACAG 0: 1
1: 0
2: 2
3: 13
4: 104
Right 968241639 3:197093875-197093897 AATTCCCCTCTCCTGGAATCTGG 0: 1
1: 2
2: 12
3: 95
4: 422
968241632_968241640 10 Left 968241632 3:197093843-197093865 CCTTGCAATTTCCCCATCGACAG 0: 1
1: 0
2: 2
3: 13
4: 104
Right 968241640 3:197093876-197093898 ATTCCCCTCTCCTGGAATCTGGG 0: 1
1: 2
2: 18
3: 120
4: 520
968241632_968241646 23 Left 968241632 3:197093843-197093865 CCTTGCAATTTCCCCATCGACAG 0: 1
1: 0
2: 2
3: 13
4: 104
Right 968241646 3:197093889-197093911 GGAATCTGGGCTAGTGCTTTGGG 0: 1
1: 0
2: 2
3: 17
4: 170
968241632_968241645 22 Left 968241632 3:197093843-197093865 CCTTGCAATTTCCCCATCGACAG 0: 1
1: 0
2: 2
3: 13
4: 104
Right 968241645 3:197093888-197093910 TGGAATCTGGGCTAGTGCTTTGG 0: 1
1: 0
2: 0
3: 13
4: 177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968241632 Original CRISPR CTGTCGATGGGGAAATTGCA AGG (reversed) Intronic
905485600 1:38293559-38293581 CTGTGGGTCGGGACATTGCAGGG + Intergenic
906634336 1:47398413-47398435 CTGTTGATGAGGGAATGGCAAGG - Intergenic
908488526 1:64619149-64619171 ATGTAGATGGTGAAATTGGAAGG + Intronic
913132242 1:115851301-115851323 CTGGGGATGGGGAAAATCCATGG - Intergenic
914021244 1:143869938-143869960 CAGTAGATGAGGCAATTGCAGGG + Intergenic
918073178 1:181148771-181148793 CTATCACTTGGGAAATTGCAAGG + Intergenic
919280438 1:195482665-195482687 GTGTCGGTGGGGGGATTGCATGG + Intergenic
923184550 1:231558167-231558189 CTGTCCATGGGGAAATGCCATGG + Intronic
924279997 1:242426937-242426959 CTGTGGATGGGTAAAAAGCATGG - Intronic
924826821 1:247548389-247548411 ATGACAATGGGGAAAATGCAGGG - Intronic
1064901690 10:20302142-20302164 CTATCGCTTGGGAAATTCCAAGG + Intergenic
1066118678 10:32262708-32262730 CTATCACTGGGGAAATTCCAAGG + Intergenic
1067092345 10:43274378-43274400 CTGTCACTGGGGAAATTCCAAGG + Intergenic
1069981330 10:72255004-72255026 CTGTTCATGGAGAGATTGCAGGG - Intergenic
1073381889 10:103084290-103084312 CTGTGGATGGAGACATTTCAGGG + Exonic
1075240600 10:120775059-120775081 CTGTAGATGGGGAAACTGCCAGG + Intergenic
1077473320 11:2774970-2774992 CTTTTGCTGGGGAATTTGCAAGG - Intronic
1079275977 11:19038097-19038119 CTTTCCATGGAGAGATTGCAGGG - Intergenic
1083029799 11:59582113-59582135 CTGTCACTTGGGAAATTACAAGG - Intronic
1083105136 11:60350000-60350022 ATGTCCATGGGGCAATTTCATGG - Intronic
1086807142 11:91257892-91257914 CTGTCTGTAGGGAAATTTCATGG - Intergenic
1087181709 11:95148589-95148611 CTGTTGATGGAGGAATGGCAAGG + Intergenic
1090288926 11:125524906-125524928 CTGTAGATGGGTGAATTGTATGG + Intergenic
1091845767 12:3655314-3655336 CTGTGGATGGGGAAATGGGGAGG + Intronic
1092134748 12:6139011-6139033 CTGTGGTTGGGGAAATTGCACGG + Intergenic
1099689214 12:85928896-85928918 CTGTCTATGTGGAAATTACAAGG + Intergenic
1101491569 12:105214612-105214634 CTATTGATGAGGAAATTACAAGG - Intronic
1105626920 13:22121686-22121708 ATGGAGATGGGGAAATTACAGGG - Intergenic
1106410835 13:29510607-29510629 CCGAGGACGGGGAAATTGCAGGG - Exonic
1106492021 13:30234849-30234871 CTGTCGCTAGGGTAATTCCAAGG - Intronic
1107889545 13:44902384-44902406 CTGTCAATGGGGAAAGCACATGG + Intergenic
1109202891 13:59450662-59450684 CTGTGGATGGGGAATTAGAATGG - Intergenic
1114596596 14:23917515-23917537 CTGTCGCTTGGGAAATTCCAAGG - Intergenic
1114822640 14:26040107-26040129 CTGTCGATGGGCAAACTTAATGG + Intergenic
1118447294 14:65863437-65863459 CTGTCCATAGGGAAATTCCAAGG - Intergenic
1118704619 14:68469240-68469262 GTCTCCATGGGGAAATTACAGGG - Intronic
1125785893 15:42317625-42317647 TTTTAGATGGGTAAATTGCATGG + Intronic
1126252321 15:46582820-46582842 CTGGAGATGGGGAGATTGCTGGG + Intergenic
1128380349 15:67107637-67107659 CTGTCGCTGTGGTTATTGCATGG + Intronic
1129825884 15:78634740-78634762 CTGTGGATGGGGACATGGGAAGG + Intronic
1129950492 15:79584717-79584739 GTGTCAAAGAGGAAATTGCAAGG - Intergenic
1130144534 15:81263814-81263836 CTGTGGATGGAGAGAATGCAGGG + Intronic
1130849126 15:87776757-87776779 CTATGGATTGGGAAACTGCAGGG + Intergenic
1131523198 15:93132363-93132385 CTTTCAATGGGCAAATTGTATGG - Intergenic
1131551541 15:93361450-93361472 CTTTCAATGGGTAAATTGAATGG - Intergenic
1133006586 16:2885008-2885030 CTTTAAATGGGTAAATTGCACGG - Intronic
1134794386 16:17021443-17021465 CTGTTGATGGGGAGAATGTAGGG + Intergenic
1135710394 16:24711487-24711509 CTGGGGATGGGGAGATTGCAGGG - Intergenic
1141313130 16:82934486-82934508 AAGACAATGGGGAAATTGCAGGG - Intronic
1143970740 17:10793487-10793509 CAGTGCATGTGGAAATTGCAGGG - Intergenic
1146932654 17:36788572-36788594 CTCTTGATGGGGAAGTTACAAGG + Intergenic
1147574079 17:41588628-41588650 CTCTCTCTGGGGAAATTGTAGGG - Intergenic
1148144320 17:45353043-45353065 CTGTAGATGGGTGAATTGTATGG + Intergenic
1148835936 17:50465773-50465795 CTGTCGAAGGGGAAGTTGGAGGG + Exonic
1151223291 17:72629933-72629955 CTGTCTATTGGGAAAATCCAGGG + Intergenic
1155308630 18:24502668-24502690 CTTTAAATGGGGGAATTGCATGG + Intergenic
1155667397 18:28327816-28327838 CTGTATATTGGGATATTGCAGGG + Intergenic
1162331491 19:10032611-10032633 CTCTCGAAGGGGAAATTGCTGGG + Intergenic
1164360313 19:27500591-27500613 CTGTTGTTGGAGAAACTGCAAGG + Intergenic
925170698 2:1748626-1748648 CTGTCCCTGGGGAAATTCCAAGG + Intergenic
929097332 2:38276207-38276229 CTGCAGATGTGGAAATAGCAAGG - Intergenic
929922136 2:46180211-46180233 ATGGAGGTGGGGAAATTGCATGG + Intronic
934524691 2:95044375-95044397 CTTTCAATGGGGGAACTGCATGG + Intronic
935729366 2:106052403-106052425 ATGTCTGTGGGGAAATTGAAAGG + Intergenic
935972616 2:108545162-108545184 CTGTTGTTGAAGAAATTGCATGG + Intronic
941641853 2:167997287-167997309 CTGTATTTGGGGAAACTGCAGGG + Intronic
942301888 2:174570999-174571021 CTGTGGATGGGGGCATTGGAAGG + Intronic
944554303 2:200872668-200872690 CTGTCACTCAGGAAATTGCAAGG + Intronic
945812911 2:214569950-214569972 CTTTTTATGGGGAAATTTCAGGG + Intronic
1175111778 20:56653480-56653502 TTGTGGATGGGGAAATAGAAAGG + Intergenic
1177315862 21:19459825-19459847 ATCTATATGGGGAAATTGCATGG - Intergenic
1180151959 21:45953198-45953220 CGGCCGATGGGGAAAGGGCACGG - Intergenic
1182889703 22:33807042-33807064 CTGTCTTTGTGGAAGTTGCATGG - Intronic
1182971829 22:34586477-34586499 CTATCACTGGGGAAATTTCAAGG - Intergenic
950969014 3:17167967-17167989 CTGCGGATGGGGAAGCTGCAGGG + Intronic
952531278 3:34264448-34264470 CTGTCTACGGGGTAATTGCAAGG - Intergenic
952646771 3:35669474-35669496 CTATGGATGTGGAAATTGCTAGG - Intronic
956051420 3:65252254-65252276 CTGCAGATGGGGAAAGAGCAAGG - Intergenic
960593845 3:119390711-119390733 CTGTGGATGGGGAATCTGGATGG + Intronic
964807277 3:160624640-160624662 CTGTCCATGTGGAGTTTGCAAGG - Intergenic
968241632 3:197093843-197093865 CTGTCGATGGGGAAATTGCAAGG - Intronic
968787922 4:2637753-2637775 CTGTCGATGGGGCATGGGCAGGG + Intronic
970671181 4:18398393-18398415 CTTTTGATGAGGACATTGCAAGG + Intergenic
975318917 4:72987549-72987571 CTGTCCGTGTGGAAATTGCAAGG - Intergenic
976369149 4:84267059-84267081 CTGTGGCAGGGGAGATTGCATGG + Intergenic
979140289 4:117163411-117163433 CTATCACTGGGGAAATTACAAGG + Intergenic
979764088 4:124444791-124444813 CTTTGGATGGGGATATTGAATGG + Intergenic
985834668 5:2261593-2261615 GTGTCGGTGGGGAAACAGCAAGG - Intergenic
988349340 5:30081570-30081592 CTGTCTATGAGGAAAATTCAAGG - Intergenic
995069106 5:107897642-107897664 CTCTAGATCAGGAAATTGCAAGG + Intronic
997377686 5:133409085-133409107 CTGGCGCAAGGGAAATTGCAAGG - Intronic
998656879 5:144191163-144191185 CTGTCAGTGGGGACATTGAATGG + Intronic
1003262422 6:4531641-4531663 CTGAAGGTGGGGAAATTTCAAGG - Intergenic
1004417892 6:15441485-15441507 CAGTGGGTGGGGAAATTGCCTGG + Intronic
1008144401 6:47873740-47873762 TTGAAGATGGGGAAATAGCAAGG + Intergenic
1009725016 6:67527390-67527412 CTGACAAGGGGCAAATTGCAGGG - Intergenic
1012810892 6:103956730-103956752 CTGGTGTTGGGGAAATTGCTAGG - Intergenic
1014422862 6:121266905-121266927 CTGTCGGTGGGGAAGGGGCAAGG + Intronic
1020864373 7:13538717-13538739 CTGACAATGGGAAAATTGAAAGG + Intergenic
1023110383 7:36805149-36805171 CACTTGATGGGGAAATAGCATGG - Intergenic
1031034249 7:116770335-116770357 CTTTCAATGGGTGAATTGCATGG - Intronic
1032093470 7:128923770-128923792 CTTTAGATGGGTAAATTGTATGG - Intergenic
1032482477 7:132257855-132257877 CTGTAGATGGAGGAATTGGAAGG + Intronic
1033797352 7:144862680-144862702 CTGTAAATGGGCAAATTACATGG - Intergenic
1034400060 7:150856364-150856386 CAGTCCATGGGAAAATTCCATGG + Intronic
1035685256 8:1519606-1519628 GTGTCCATGGGGAAGGTGCATGG - Intronic
1038160403 8:25031642-25031664 CTGTAGATGGGGAGTCTGCACGG - Intergenic
1039078225 8:33711464-33711486 ATGTCGATGGAGAAATTTCTAGG - Intergenic
1039669727 8:39582424-39582446 CTTTAAATGGGTAAATTGCATGG + Intergenic
1041695155 8:60728158-60728180 CTGTTGATGGGAAATTTGCCAGG + Intronic
1042561851 8:70077924-70077946 CTGTATCTGGGGAAATTTCAAGG + Intergenic
1042937749 8:74077327-74077349 CTGTCGCTCAGGAAATTCCAAGG + Intergenic
1044083636 8:87916193-87916215 GTTACGATGGGGAAATTGCCAGG - Intergenic
1057051721 9:91928851-91928873 ATGTAGATGAGGAAAGTGCAGGG - Intronic
1057067998 9:92073105-92073127 CTCTCAAAGGGGAAATTGCTGGG - Intronic
1060509304 9:124220610-124220632 CTGTTGATGGTGAAATGGGAAGG - Intergenic
1188795029 X:34453087-34453109 CTTTCGATGGATTAATTGCATGG + Intergenic
1198285938 X:135192003-135192025 CTGTAGATGGGGGAATTGCATGG + Intergenic
1198287179 X:135202750-135202772 CTGTAGATGGGAGAATTGCATGG - Intergenic
1200140329 X:153898047-153898069 CTCTTGATGGGGAAGTGGCAAGG + Intronic