ID: 968244132

View in Genome Browser
Species Human (GRCh38)
Location 3:197124696-197124718
Sequence TGTGGTCCCAATTATTTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 14270
Summary {0: 1, 1: 3, 2: 73, 3: 1206, 4: 12987}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968244132_968244136 -2 Left 968244132 3:197124696-197124718 CCTGCCAAATAATTGGGACCACA 0: 1
1: 3
2: 73
3: 1206
4: 12987
Right 968244136 3:197124717-197124739 CAGGCACGCACCATTGTGCCTGG 0: 1
1: 35
2: 514
3: 4817
4: 30310

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968244132 Original CRISPR TGTGGTCCCAATTATTTGGC AGG (reversed) Intronic
Too many off-targets to display for this crispr