ID: 968257653

View in Genome Browser
Species Human (GRCh38)
Location 3:197292002-197292024
Sequence CAGTCTCACCAGCAGCACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 340
Summary {0: 1, 1: 0, 2: 8, 3: 40, 4: 291}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968257653_968257654 -1 Left 968257653 3:197292002-197292024 CCTGTGTGCTGCTGGTGAGACTG 0: 1
1: 0
2: 8
3: 40
4: 291
Right 968257654 3:197292024-197292046 GTAAAATGCTGCAATCACTATGG 0: 1
1: 2
2: 45
3: 418
4: 2076
968257653_968257657 15 Left 968257653 3:197292002-197292024 CCTGTGTGCTGCTGGTGAGACTG 0: 1
1: 0
2: 8
3: 40
4: 291
Right 968257657 3:197292040-197292062 ACTATGGAAAACATTATGGTGGG 0: 1
1: 1
2: 23
3: 104
4: 393
968257653_968257655 11 Left 968257653 3:197292002-197292024 CCTGTGTGCTGCTGGTGAGACTG 0: 1
1: 0
2: 8
3: 40
4: 291
Right 968257655 3:197292036-197292058 AATCACTATGGAAAACATTATGG 0: 2
1: 40
2: 562
3: 2521
4: 5881
968257653_968257656 14 Left 968257653 3:197292002-197292024 CCTGTGTGCTGCTGGTGAGACTG 0: 1
1: 0
2: 8
3: 40
4: 291
Right 968257656 3:197292039-197292061 CACTATGGAAAACATTATGGTGG 0: 4
1: 137
2: 939
3: 2370
4: 3266

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968257653 Original CRISPR CAGTCTCACCAGCAGCACAC AGG (reversed) Intronic
900150337 1:1176078-1176100 CAGTCTCTCCACCTGCACAGCGG - Intronic
900322381 1:2091476-2091498 CAGTCCCACCTGCAGCACACAGG + Intronic
903105546 1:21076045-21076067 CATTCTCTTCATCAGCACACGGG + Intronic
903537117 1:24074347-24074369 CAGGCTCACCAGAAGCAACCTGG - Intronic
904021514 1:27470102-27470124 CAGTGTCAGCAGAAGCACAAAGG + Intronic
905017207 1:34785953-34785975 CAGACACAACAGCAGCACAGAGG + Exonic
905671773 1:39795706-39795728 CTCTCTGACCAGCAGCATACAGG + Intergenic
906688569 1:47778138-47778160 CAGTCTTCCAAGCAGCACCCAGG + Intronic
908171411 1:61508517-61508539 CATTCCCACCAGCAGTGCACAGG - Intergenic
908322898 1:62995135-62995157 CAATCTCACCTGCAGGCCACTGG - Intergenic
908373730 1:63511329-63511351 CATTCCCACCAGCAGTACACAGG - Intronic
910689710 1:89953510-89953532 CAGTCTCCCCAGCAACTCAGAGG - Intergenic
911400051 1:97363337-97363359 CAGTCTCACCAACAGTATAAAGG - Intronic
913541401 1:119824484-119824506 CATTCCTACCAACAGCACACAGG - Intergenic
915885007 1:159713041-159713063 CAGTCTCAGAATCAGGACACTGG - Exonic
916514111 1:165499232-165499254 CAGTATCATCAGCATCACCCTGG - Intergenic
916841825 1:168609029-168609051 CACTCTCGCCAGCAGGAAACTGG + Intergenic
916962620 1:169904560-169904582 CAGTATCACCAGGAGAACACAGG - Intergenic
917157783 1:172023497-172023519 CAGTCTTCCTAGCAGCAAACTGG - Intronic
917572105 1:176278258-176278280 CAGTCTCTCCCCCAGCACATGGG - Intergenic
917645424 1:177024574-177024596 CAGGCTCACCATCAGCAATCAGG + Exonic
919146147 1:193637942-193637964 CATTCCCACCAACAGTACACAGG + Intergenic
921350428 1:214229071-214229093 CATTCTCATCAGCTGAACACAGG + Intergenic
921650682 1:217674534-217674556 CATTCTCAACACCAGCACAGGGG + Intronic
921876836 1:220206608-220206630 ATGTCTCACCAAGAGCACACTGG - Intronic
922180231 1:223227650-223227672 CAGCAGCACCAGCAGCACACTGG + Exonic
922227927 1:223661697-223661719 CATTCCCACCAGCAGTGCACAGG - Intronic
922719033 1:227890956-227890978 CAGTTTCCCCATCTGCACACAGG - Intergenic
923332476 1:232938232-232938254 TAGGCTCACCAGCAGGTCACTGG + Intergenic
1064353207 10:14595853-14595875 CCATCTCACCAGCGGCACCCCGG + Intronic
1065159341 10:22903020-22903042 CAGTCTCAGCAGCAGCAGAATGG + Intergenic
1066688447 10:38003209-38003231 CAGTCACAGGAGCAGCACAGAGG - Intergenic
1067879129 10:50028506-50028528 CTGTCTCACCAACATCACACAGG + Intergenic
1067939096 10:50637547-50637569 CCGTCTCACCAGCAGACCATAGG - Intergenic
1069087224 10:64155174-64155196 CAGTCTCATCAGCTGCAAAATGG - Intergenic
1069667168 10:70170467-70170489 CACACTAACCAGCAGCACCCGGG + Exonic
1070037447 10:72740755-72740777 CACACTTAACAGCAGCACACTGG - Intronic
1070493578 10:77000021-77000043 CAGCCTCAACACCAGCACAGGGG + Intronic
1070694843 10:78554587-78554609 CAGTCATACCATCAGCACCCAGG + Intergenic
1071159760 10:82731879-82731901 CATTCCCACCAGCAGTGCACAGG + Intronic
1071872684 10:89812752-89812774 CATTCCCACCAACAGCACAAAGG + Intergenic
1072785054 10:98273610-98273632 CTGTCTCAGCAGCTGGACACAGG + Intergenic
1073309925 10:102533088-102533110 CTGTCTGACCAGCTGCACATGGG + Intronic
1073545551 10:104345673-104345695 CAGTCTTTCCAGCAGCACAGAGG + Intergenic
1073974591 10:109086441-109086463 CAGTCCCACCAACAGTACAAAGG - Intergenic
1075228786 10:120653668-120653690 CAGACTCACCAGCAGCAAGGAGG + Intergenic
1075854880 10:125621300-125621322 CATTCCCACCAGCAGAGCACAGG + Intronic
1076311737 10:129512785-129512807 CATTCCCACCAGCAACACACAGG - Intronic
1076338852 10:129728831-129728853 CAGCGTCACCAGCATCACAAAGG + Intronic
1076525236 10:131108543-131108565 CTGTCTCAGCAGCCTCACACAGG + Intronic
1076582343 10:131520208-131520230 CAGCCTCACCAGGAAGACACTGG + Intergenic
1076678491 10:132160014-132160036 GAGGCTCCCCAGCATCACACAGG - Intronic
1076678571 10:132160329-132160351 GAGGCTCCCCAGCATCACACAGG - Intronic
1076678591 10:132160407-132160429 GAGGCTCCCCAGCATCACACAGG - Intronic
1076678800 10:132161141-132161163 GAGGCTCCCCAGCATCACACAGG - Intronic
1076678883 10:132161427-132161449 GAGGCTCCCCAGCATCACACAGG - Intronic
1076695410 10:132244892-132244914 CAGCCTCACCAGCAACAAAACGG + Intronic
1076731235 10:132440238-132440260 CTGTCTCCCCCCCAGCACACGGG + Intergenic
1076731310 10:132440506-132440528 CTGTCTCCCCCCCAGCACACAGG + Intergenic
1076731322 10:132440540-132440562 CTGTCTCCCCCCCAGCACACGGG + Intergenic
1076731334 10:132440574-132440596 CTGTCTCCCCCCCAGCACACGGG + Intergenic
1077084754 11:743723-743745 CATTCCCACCAGCAGCGCATGGG + Intergenic
1077341805 11:2029550-2029572 CCGCCTCACCAGGAGCAGACTGG - Intergenic
1077348281 11:2074946-2074968 CACTCTCACCAGCAGTGCCCGGG + Intergenic
1077437321 11:2549236-2549258 CAGTGCCACCAGGAGCCCACTGG + Intronic
1078341349 11:10499814-10499836 CACTGTCACCACCACCACACAGG + Intronic
1078424519 11:11238484-11238506 CAGGCTCTGCAGCAGCACATGGG - Intergenic
1079165503 11:18037838-18037860 CAGTTTGGCCAGAAGCACACAGG + Intronic
1079348948 11:19676683-19676705 CAATGACACCACCAGCACACTGG - Intronic
1080632978 11:34096538-34096560 CAGCCTCCTCAGCAGAACACTGG + Exonic
1081683679 11:45026526-45026548 CAGTCACAGCAGCAACACAGTGG + Intergenic
1083181119 11:60986307-60986329 CAGTCTCACCAGCAGGAAGGTGG + Intronic
1083750817 11:64759638-64759660 CAGGCTCCCCAGCAGCACCTTGG + Exonic
1083915558 11:65741041-65741063 CACTCTGACCAGCAGATCACTGG - Intergenic
1084143871 11:67253023-67253045 CAGTCTCCCAGGCAGCACTCTGG + Intronic
1084362409 11:68677543-68677565 CAGGCCCATCAGCAGCACCCAGG - Intergenic
1084567211 11:69937888-69937910 CAGTGGCACCCTCAGCACACTGG + Intergenic
1084860745 11:72016366-72016388 CACACCAACCAGCAGCACACAGG + Intronic
1202824791 11_KI270721v1_random:84739-84761 CCGCCTCACCAGGAGCAGACTGG - Intergenic
1092216178 12:6684733-6684755 CAGCCTCATCAGTAGCACAGTGG - Intronic
1092727717 12:11500874-11500896 CAGTCGCCCCATCAGCACCCGGG + Intronic
1094416851 12:30225428-30225450 CTGTTTCACCAGCATCACACAGG - Intergenic
1095617267 12:44205795-44205817 CATTCCCACCAGCAGCATATAGG - Intronic
1101219383 12:102621361-102621383 CATTCTCACCAGCAGCCAATGGG - Intergenic
1101899848 12:108783609-108783631 CAGTCTCTCCAGAACCACCCAGG + Exonic
1102358023 12:112256442-112256464 CAGTCTTTCCAGCAGCCCATGGG + Exonic
1105027111 12:132856759-132856781 CAGTCCCTCCACCAGCACCCGGG - Intronic
1106097576 13:26661712-26661734 CATTCTCACCAACAGCGCACAGG + Intronic
1106817824 13:33429058-33429080 CATTCCCATCAACAGCACACAGG - Intergenic
1107017311 13:35717965-35717987 CAGCCTCACCAGGAGCCCAGAGG + Intergenic
1108335892 13:49441979-49442001 CAGTCTCACCAGCAAGACTAAGG + Intronic
1108466190 13:50717998-50718020 CAGCCTCATCAGCATCACATGGG + Intronic
1108563557 13:51671321-51671343 CATTCCCACCAGCAGCGCAGAGG + Intronic
1109864600 13:68246331-68246353 AAGTCTCACCAGCAACAATCTGG + Intergenic
1114357717 14:21930911-21930933 CATTTTCACCAACAGGACACAGG + Intergenic
1115691784 14:35851686-35851708 CATTCCCACCAACAGTACACAGG - Intronic
1115962635 14:38852846-38852868 CATTATCATCATCAGCACACAGG + Intergenic
1116286276 14:42976060-42976082 CCTTCTCACCAGCAGCATATCGG + Intergenic
1117462113 14:55955588-55955610 CCGTATCACCACCAGCACCCTGG - Intergenic
1118807471 14:69250573-69250595 CTGCCTCCCCAGCTGCACACAGG - Intergenic
1119566303 14:75631993-75632015 CAGTCTCCTGAGCAGCACAGTGG - Intronic
1120054094 14:79901762-79901784 CAGTCCCACCAACAGTGCACAGG + Intergenic
1120724932 14:87927782-87927804 AAGTTTCACCAGCACCACAAAGG + Intronic
1122409498 14:101518662-101518684 CAGTCTCACCAGCTGTGCCCTGG + Intergenic
1122752492 14:103948377-103948399 CATTCTCACCAACAGTACACAGG - Intronic
1124338343 15:28873782-28873804 CACCCTCACCAGCAGAACGCTGG - Intergenic
1125795898 15:42403690-42403712 CAGTGTCACCAGAAGCAAGCAGG - Intronic
1126937739 15:53729853-53729875 CATTCCCACCTGCAGTACACAGG - Intronic
1129559115 15:76547150-76547172 CACTCTCACCAGCAGTGTACAGG + Intronic
1129880252 15:79001722-79001744 CAGTATCACCATCATCACTCTGG + Exonic
1131764937 15:95665519-95665541 CTGGCAGACCAGCAGCACACTGG - Intergenic
1132596751 16:754922-754944 CCTGCTCACCGGCAGCACACGGG + Intronic
1132596768 16:755000-755022 CGTGCTCACCGGCAGCACACGGG + Intronic
1132697556 16:1208733-1208755 CCGTGTCCCCAGGAGCACACTGG - Intronic
1132911324 16:2314023-2314045 CATTCCCACCAGCAGCACACAGG - Intronic
1133070818 16:3245708-3245730 CATTCCCACCAGCAGCACACAGG - Intronic
1133962878 16:10509992-10510014 CAGTTCAACCAGCTGCACACGGG - Intergenic
1136413197 16:30088957-30088979 CAAGCTCACCAACAGCACGCTGG - Exonic
1136573228 16:31108910-31108932 CCGTCTCCCCAGATGCACACAGG - Intronic
1137994298 16:53193081-53193103 CATTCCCACCAGCAGCATATAGG + Intronic
1141764611 16:86050255-86050277 CAGTCTCTGAAGCAACACACGGG + Intergenic
1141987991 16:87592421-87592443 CCTTCCCACCAGCAGCATACAGG - Intergenic
1142138836 16:88463584-88463606 CAGTTTCCCCATCTGCACACTGG - Intronic
1143557943 17:7674191-7674213 CATCCTCACCATCATCACACTGG - Exonic
1143670473 17:8392808-8392830 CTTCCTCACCAGCAGCACCCAGG + Exonic
1143864037 17:9911181-9911203 CAGCATCACCTGCAGCAGACGGG - Intronic
1145235622 17:21206161-21206183 CATTCCCACCAGCAGCGCACAGG + Intronic
1146007514 17:29169979-29170001 CGGTCACAGCAGCAGCACAAGGG + Intronic
1146290432 17:31602869-31602891 CACCCTCACCAACAGCACCCAGG + Intergenic
1146709174 17:35026256-35026278 CTGGGTCACCAGCATCACACAGG + Intronic
1149428824 17:56580455-56580477 CATTCCCACCAGCAGCACACAGG + Intergenic
1151821179 17:76497725-76497747 CAGTTTCCCCAGCTGCACAGTGG - Intronic
1151949719 17:77344392-77344414 CATTCCCACCAGCAGTGCACGGG - Intronic
1151998262 17:77626683-77626705 CATTCCCAGCAGCAGGACACAGG + Intergenic
1152447380 17:80353691-80353713 AAGCATCACCAGCAGCACAAGGG - Intronic
1152464879 17:80460440-80460462 CATTCCCACCAGCAGTGCACAGG - Intergenic
1152583000 17:81176645-81176667 CATTCCCACCAACAGCGCACAGG - Intergenic
1152727138 17:81952976-81952998 CAGCATCCCCAGCAGCTCACTGG + Exonic
1152869723 17:82746150-82746172 CATTCCCACCAGCAGCATATGGG + Intronic
1153333211 18:3895756-3895778 CTGTTTCATCCGCAGCACACAGG + Intronic
1157573950 18:48731285-48731307 CAGCCTCACCAGCAGCTGATGGG + Intronic
1158598743 18:58839017-58839039 CAGTCCCATCAGAACCACACAGG + Intergenic
1158915441 18:62121979-62122001 CATTCCCACCAACAGTACACAGG + Intronic
1159320879 18:66846270-66846292 CAGTTTCACCAGCAGTGCAGTGG - Intergenic
1160305050 18:77725068-77725090 CAGTCTCTCCCACAGCACATGGG - Intergenic
1160768167 19:817887-817909 CAGTCTCACCAGCTGCAAAATGG + Intronic
1160794479 19:938545-938567 CCGTCCCACCAGCAGCTCCCTGG - Intronic
1161142463 19:2656096-2656118 CATTCCCACCAACAGCACACAGG - Intronic
1161322625 19:3648409-3648431 CAGCCGCACCAGCAGCTCTCGGG - Intronic
1162684016 19:12366747-12366769 CAGCCTCCCGAGTAGCACACTGG + Intergenic
1163692554 19:18745460-18745482 CAGTCTCACCAGGTGCAGACAGG - Intronic
1166999550 19:46737911-46737933 CAGACACACGAGCAGCTCACGGG - Intronic
925341928 2:3143849-3143871 CACACACACCAGCAGCACACAGG + Intergenic
926733014 2:16051404-16051426 CAGGCTCACCAGCAACACACGGG + Intergenic
927389930 2:22583284-22583306 AAGTCTCTCCAGCAACACATGGG - Intergenic
927501890 2:23588554-23588576 CAGTCTAAGAAGCACCACACTGG - Intronic
928735357 2:34282494-34282516 CACCCACACCAGCAGCACAGTGG + Intergenic
929943327 2:46351795-46351817 CATTCTGACCAGCAGCACCGTGG + Intronic
931633652 2:64323028-64323050 CAGTCCCACCAGCTGCAAAATGG + Intergenic
932871405 2:75402732-75402754 CATTCCCACAAACAGCACACAGG + Intergenic
934150359 2:89142624-89142646 CACTCTCACCATCAGCAGACTGG - Intergenic
934216934 2:90039407-90039429 CACTCTCACCATCAGCAGACTGG + Intergenic
934996564 2:98967135-98967157 CAGTGGCAGCAGCAGCACACTGG + Intergenic
935956663 2:108383686-108383708 CAGTCTCACCTGCAGCTTCCTGG + Intronic
936028623 2:109053681-109053703 CTGTCTCACCAGAATCAGACAGG + Intergenic
936274994 2:111088178-111088200 CACTCCCACCAGCAGTACATAGG - Intronic
937288424 2:120767441-120767463 CCCTCTCACCAGCGGCAGACTGG - Intronic
937349666 2:121152973-121152995 CAAACGCACCAGCAGCACAAGGG - Intergenic
937816726 2:126258904-126258926 CATTCTCAACTGCAGGACACAGG + Intergenic
937834501 2:126458797-126458819 CAGTGTCCCTAGCACCACACTGG + Intergenic
938962823 2:136358430-136358452 CATTCTCACCAGCAGTATATGGG + Intergenic
942938169 2:181583614-181583636 CAGCATCACCAGCAGCTCACTGG + Intronic
943329138 2:186537810-186537832 CATTCTCACCAGCAGCGAATGGG + Intergenic
944144131 2:196487505-196487527 AAGTCTCAACATCAGCACATTGG - Intronic
944709039 2:202319329-202319351 CAGGGTCACCAGCAGCACCATGG + Intergenic
948182054 2:235989801-235989823 CGGTCACAGCAGCAGCTCACAGG + Intronic
948761558 2:240195222-240195244 CATTCTCACCCGCAGTGCACTGG + Intergenic
948923347 2:241077859-241077881 CAGTCCCACCAGCAGCGTAGAGG - Intronic
949055192 2:241924168-241924190 CAGAGTCACCACCAGCACAAAGG - Intergenic
1170295485 20:14820035-14820057 CACCTTCACCAGCAGCACTCCGG - Intronic
1171092634 20:22300127-22300149 CATTCTTACCAACAGCACACAGG + Intergenic
1172034020 20:31999387-31999409 CACCCTCCCCACCAGCACACAGG + Exonic
1172299819 20:33841462-33841484 CAGGCTCACCTGCAGGACAAGGG - Intronic
1174733872 20:52945371-52945393 CAGTGGCATCAGCAGCATACAGG - Intergenic
1175187474 20:57188751-57188773 CTGCCTCACCAGCAGCAGACTGG + Intronic
1175428309 20:58884923-58884945 CAGACCCATCAGCAGAACACAGG - Intronic
1175582665 20:60112616-60112638 CAGCATCAGCAGCAGCACAGTGG + Intergenic
1175675847 20:60945954-60945976 CAGGATGACCAGCAGCAGACAGG + Intergenic
1176047882 20:63102106-63102128 CAGTCTTACCCGCAGCTGACAGG + Intergenic
1178504787 21:33153676-33153698 CAGTCTCCCCTGCAGCACCGAGG + Intergenic
1179075077 21:38113416-38113438 CAGTCACACCAGCAGCATTTTGG + Intronic
1179078129 21:38143355-38143377 GCCTCTCACCTGCAGCACACAGG + Intronic
1179368994 21:40786436-40786458 CAGCAGCATCAGCAGCACACGGG + Intronic
1179640737 21:42745811-42745833 CAGCCCCACCAGCAGCACGAGGG + Intronic
1179731431 21:43369926-43369948 CAGTGTCCCCTCCAGCACACAGG + Intergenic
1181684093 22:24516579-24516601 CAGTGTCCCCAGCAGGACAGGGG + Intronic
1182547727 22:31085441-31085463 CAGTCTCCCCAACAGCACAACGG - Intronic
1184380093 22:44140053-44140075 CAGTTTCACAAGCAGCACAATGG - Intronic
1185324553 22:50219361-50219383 CAGTCTCATCAGCGGCAGACTGG + Exonic
950460357 3:13117978-13118000 CACTCCCACCAGCAGTGCACAGG - Intergenic
950764671 3:15264996-15265018 GATTCTCACCATCTGCACACAGG + Intronic
953141620 3:40234475-40234497 CAGTGTCTCCAGCAGCCCAAAGG + Intronic
954475751 3:50743891-50743913 CATTCCCACCAGCAGTGCACAGG + Intronic
954628859 3:52037563-52037585 CAGTCTCCCCATCTACACACTGG - Intergenic
955285921 3:57641936-57641958 CGGTCCTTCCAGCAGCACACAGG + Intronic
955497613 3:59551586-59551608 CACTCCCACCAGCTGCATACAGG + Intergenic
956371399 3:68566323-68566345 CATTCTCACCAACAGTGCACAGG + Intergenic
956641995 3:71424185-71424207 TAGTCTCACCAGCAGCAAGAAGG + Intronic
960819814 3:121717308-121717330 CTGACTCCCCAGCAGCACACAGG + Intronic
961052348 3:123757577-123757599 CAGACTGCCCAGCAGGACACTGG + Intronic
961096711 3:124162990-124163012 CATCCTCACCAGGACCACACAGG + Intronic
961323808 3:126097837-126097859 CAGTCACCACACCAGCACACAGG + Intronic
962090221 3:132236454-132236476 CATTCTCACCAACAGTACACAGG - Intronic
967328305 3:188264678-188264700 AAAGCTGACCAGCAGCACACAGG + Intronic
967917641 3:194590649-194590671 CAGCCACACCAGAAGCACCCAGG + Intronic
968041254 3:195591164-195591186 CAGTCTTCCCAGCAGAACAAGGG + Intergenic
968052768 3:195667051-195667073 CATTCCCACCAACAGCACACAGG - Intergenic
968103041 3:195981305-195981327 CATTCCCACCAACAGCACACAGG + Intergenic
968257653 3:197292002-197292024 CAGTCTCACCAGCAGCACACAGG - Intronic
968301359 3:197618889-197618911 CATTCCCACCAACAGCACACAGG + Intergenic
968460033 4:720220-720242 CACCCTCCCCAGCGGCACACAGG - Intronic
969256614 4:6006794-6006816 CAGTCCCCATAGCAGCACACAGG - Intergenic
970922924 4:21416026-21416048 CAGTCTCACCATCAGAAGGCTGG + Intronic
971104373 4:23506483-23506505 CATTCTCACGAGCAGCATATAGG + Intergenic
971430367 4:26559227-26559249 CATTCCCACCAATAGCACACTGG + Intergenic
972332890 4:38080159-38080181 CACTCCCTCCAGCAGCACAGGGG - Intronic
972429021 4:38962598-38962620 CATTCTCACCAACAGTGCACAGG + Intergenic
974179796 4:58369746-58369768 CATTCTCAACAGCAGTATACAGG - Intergenic
976195395 4:82527183-82527205 CATTCTCACCGGAAACACACAGG - Intronic
978761171 4:112357543-112357565 CATCCTCACCAGTGGCACACTGG + Intronic
980420092 4:132547600-132547622 CAGTTTCACTAGCAGTACTCTGG + Intergenic
981925185 4:150131631-150131653 CAGTCTCTCCAGTAACACCCAGG - Intronic
982736590 4:159013120-159013142 CATTTTCACCAGCAACATACAGG - Intronic
984568621 4:181362671-181362693 CAGACTCACCAGCAGGAAAAAGG + Intergenic
985499014 5:229152-229174 CATTCCCACCAACAGCACACAGG - Intronic
985643852 5:1075927-1075949 CAGTCTCATCAGCTGCGCAGGGG + Intronic
988032864 5:25787526-25787548 CATTTTCATCAGCAACACACAGG + Intergenic
988527807 5:32001756-32001778 TAGTCTCATCAACAGCACATCGG - Intronic
988527817 5:32001845-32001867 TAGTCTCATCAACAGCACATCGG - Intronic
988536534 5:32073935-32073957 CAGTCTCCCCGGAAGCCCACAGG + Exonic
988829646 5:34974998-34975020 CATTCTCACCAGCAGTGTACAGG + Intergenic
989308681 5:39987602-39987624 GAGTGTCACCAACAGCACAGTGG - Intergenic
990388425 5:55292129-55292151 CATTCCCACCAACAGTACACAGG + Intronic
992193764 5:74319482-74319504 CATTCCCACCAGCAGTGCACAGG - Intergenic
993661667 5:90645191-90645213 CAGTCTCAGCACCGGGACACGGG + Intronic
994694513 5:103057564-103057586 CACTCCCACCAGCACCACAACGG + Intergenic
995582686 5:113617660-113617682 CAGTCTCATCAACAGCCCAAGGG + Intergenic
996566165 5:124881469-124881491 CTGTTTCACCAGCTGCACACTGG + Intergenic
997472006 5:134122403-134122425 CAGTTTCCACGGCAGCACACGGG + Intronic
998601827 5:143592594-143592616 CAGGCTCCCCACCAGCCCACTGG + Intergenic
998696073 5:144641387-144641409 CATTCTCACCAGCAATGCACAGG + Intergenic
998805535 5:145914759-145914781 CCTTCTCACCAGCAGCAGAGTGG + Intergenic
998950261 5:147386619-147386641 CAGTCACAGAAGCAGCTCACTGG - Exonic
999723223 5:154414157-154414179 CACTCCCACCAGCAGCATACAGG - Intronic
1001740700 5:174050773-174050795 CAGTCTCTCCAGCACCAGGCAGG - Intronic
1002816324 6:684235-684257 CACTCTCTCCAGCTGCACATAGG - Intronic
1002898434 6:1392284-1392306 CAGTCTCGGCAGGACCACACCGG + Intronic
1003274623 6:4638826-4638848 CACTCCCACCAGCAGCATATCGG + Intergenic
1003348875 6:5297029-5297051 CATTCCCACCAGCAGAGCACAGG + Intronic
1005565745 6:27092225-27092247 CAGTGGCACCAGCAGCACTTGGG - Intergenic
1005802404 6:29440461-29440483 CAGCCCCACCAGCACCCCACAGG - Exonic
1006153412 6:32001397-32001419 CAGTCTCACCCTCAGCACACTGG - Exonic
1006159720 6:32034134-32034156 CAGTCTCACCCTCAGCACACTGG - Exonic
1006421171 6:33935131-33935153 CAGCCTCACCAGCAGCTCCCCGG + Intergenic
1009896191 6:69753470-69753492 TATTCCCACCAGCAGCACACAGG - Intronic
1010215438 6:73397161-73397183 CAATCCCACCAACAGTACACAGG + Intronic
1010557537 6:77302432-77302454 CACTCTCACCAACAGTATACAGG + Intergenic
1011328628 6:86178776-86178798 CATTTCCACCAGCAGCACAGAGG + Intergenic
1012659082 6:101863600-101863622 GAGATTCACCAGCAGAACACTGG - Intronic
1013663223 6:112320068-112320090 CATTCCCACCAGCAGTACATAGG - Intergenic
1017358555 6:153539630-153539652 TATTCTCACCAGCAGCATATGGG - Intergenic
1017954564 6:159167990-159168012 CTGTCTCACCAGCAGCCACCCGG - Intergenic
1018750768 6:166802646-166802668 CAGTTTCTCCAGCTGCAAACTGG - Intronic
1018980314 6:168596541-168596563 CTGCCTCTCCAGCAGCACCCGGG - Intronic
1019137791 6:169922146-169922168 CAGTCTCCCCACCAGCAGCCTGG - Intergenic
1021340514 7:19457943-19457965 CAGTATCAACAGCAGCTCATTGG + Intergenic
1024171306 7:46790878-46790900 CAGGCTCACCTGAAACACACAGG - Intergenic
1024207134 7:47173395-47173417 CAGTCTCAGAAGCTGGACACAGG - Intergenic
1024213956 7:47230925-47230947 CACTCACACCAGCAGAGCACAGG - Intergenic
1026975831 7:74497621-74497643 CATCCCTACCAGCAGCACACAGG + Intronic
1027565221 7:79783333-79783355 CATTCTCACCACCATCTCACTGG + Intergenic
1028902425 7:96116376-96116398 CAGACACACCCCCAGCACACTGG - Intergenic
1029179882 7:98692767-98692789 CAGTCTCACCAAGAGCTCAGAGG + Intergenic
1035146641 7:156824290-156824312 CAGTCTCAGCAGAAGCTTACGGG + Intronic
1035467338 7:159088215-159088237 CAGCATCTGCAGCAGCACACTGG + Intronic
1036285475 8:7441332-7441354 CCCTCTCTCCAGGAGCACACAGG - Intergenic
1036335999 8:7870197-7870219 CCCTCTCTCCAGGAGCACACAGG + Intergenic
1036658016 8:10690379-10690401 TAGTCTCCCCAGGAGCACAAAGG + Intronic
1037821308 8:22136114-22136136 CCGACTCACAAGCAGCACAATGG + Intergenic
1037886971 8:22600389-22600411 AAGTCTCTCCTGCAGCTCACCGG - Intronic
1038200177 8:25404828-25404850 CACTCCCACCAGCAACACACAGG + Intronic
1038291438 8:26253095-26253117 CAGTCTCACCTGTGGCACAGTGG - Intergenic
1039128516 8:34232350-34232372 CAGTATCTGCATCAGCACACTGG + Intergenic
1041019600 8:53625351-53625373 CATTCTCACCAGCAATACACAGG - Intergenic
1041834339 8:62195073-62195095 TAGTCTCACCTGCAGTAGACAGG - Intergenic
1044143116 8:88679002-88679024 AAGTGTCACCAGAAGCTCACAGG + Intergenic
1044860359 8:96517050-96517072 CATTCCCACCAGCAGTGCACAGG + Intronic
1045710063 8:104972983-104973005 AGGTCTTAACAGCAGCACACAGG + Intronic
1048518693 8:135134387-135134409 CAGTCTAGCCAGCAGCACACAGG + Intergenic
1049029863 8:140026441-140026463 CATTCCCACCAGCAGTGCACAGG + Intronic
1049207044 8:141368427-141368449 GAGTATCAGCAGAAGCACACGGG - Intergenic
1049289789 8:141795730-141795752 CAGTCCTCTCAGCAGCACACTGG + Intergenic
1049425751 8:142537210-142537232 CAGTTTCCCCAACTGCACACTGG - Intronic
1049633827 8:143674935-143674957 CATTCCAAACAGCAGCACACAGG - Intergenic
1049867162 8:144946630-144946652 CAGGCCCAACAGCAGGACACAGG - Intronic
1049867262 8:144947030-144947052 CAGGCCCAACAGCAGGACACAGG - Intronic
1053303757 9:36969608-36969630 CAGTCTCCCCAGAAGCAGACTGG + Intronic
1053537381 9:38938883-38938905 CTGTGTCACCAGGAGCTCACAGG - Intergenic
1054628754 9:67425047-67425069 CTGTGTCACCAGGAGCTCACAGG + Intergenic
1054828714 9:69599663-69599685 CAGTAGCACCAGCAGTACCCAGG + Intronic
1056623003 9:88230146-88230168 CAGACTCACCAGAAGTAGACAGG - Intergenic
1057138585 9:92713173-92713195 CAGGCTCGCCAGGAGCCCACTGG - Exonic
1057537418 9:95926122-95926144 CATTCCCACCAGCAGCAGATGGG - Intronic
1057874888 9:98746427-98746449 CAGTCTCACCATCAGACCAGAGG + Intronic
1057900595 9:98944847-98944869 CAGTTTCTCCAGCAGAACTCAGG + Intronic
1058912111 9:109530667-109530689 CATTCCCACCAGCAGTGCACAGG + Intergenic
1059844264 9:118254823-118254845 CATTCCCACCAACAGCATACAGG + Intergenic
1060136172 9:121156462-121156484 CAGTTTCACCAGCAAAGCACTGG - Intronic
1060392529 9:123290110-123290132 CATTCCCACCAGCAACACATGGG + Intergenic
1060940322 9:127539708-127539730 CTGACTCACCAGCAGCTCACAGG - Intronic
1061812194 9:133168724-133168746 CTGACTCACCAGCTGCAAACTGG + Intergenic
1062263478 9:135675409-135675431 CATTCCCAGCAGCAGCACTCAGG + Intergenic
1062712421 9:137983873-137983895 CAGACACACCAGGAGGACACAGG - Intronic
1185714093 X:2327442-2327464 GATGCTCACCTGCAGCACACAGG - Intronic
1186508395 X:10111823-10111845 CAGTGTCATCAGCAGCAAATGGG + Intronic
1188274297 X:28180746-28180768 CAGTAACATCAGCATCACACAGG + Intergenic
1188630823 X:32357925-32357947 CAGTCACTCCAGCAACACAGAGG - Intronic
1190170230 X:48106600-48106622 CAGTCTCAACATCTGCGCACTGG + Intergenic
1190188141 X:48253960-48253982 CAGTCTCAACATCTGCATACTGG + Intronic
1190657035 X:52621724-52621746 CAGTCTCAACATCTGCACACTGG + Intergenic
1191029757 X:55956512-55956534 CAGTCCTACCAGCAGTGCACAGG + Intergenic
1192191481 X:68994005-68994027 CATCCTCACCAGAAGCACACAGG - Intergenic
1192223046 X:69210398-69210420 CAGTCTCCCCATCAGCAAAATGG + Intergenic
1192910993 X:75604158-75604180 CACTCTCACCAGAAATACACTGG + Intergenic
1193361931 X:80589087-80589109 CATTCCCACCAGCAGCGTACAGG - Intergenic
1195401071 X:104461888-104461910 CAATCCCACCAGCAATACACAGG + Intergenic
1200895237 Y:8368897-8368919 CAGTCCCACCAACAGCATAATGG - Intergenic
1201072940 Y:10165895-10165917 CAGCTTCACAAACAGCACACAGG - Intergenic
1201853809 Y:18518823-18518845 CATTCTCACCAGCAATGCACAGG - Intergenic
1201879512 Y:18801561-18801583 CATTCTCACCAGCAATGCACAGG + Intronic