ID: 968258028

View in Genome Browser
Species Human (GRCh38)
Location 3:197297432-197297454
Sequence AATTAAGAACAGACAGAAGT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 598
Summary {0: 1, 1: 0, 2: 4, 3: 30, 4: 563}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968258023_968258028 -1 Left 968258023 3:197297410-197297432 CCTTGGAGTGGGTACCCCTCCAA 0: 1
1: 0
2: 1
3: 1
4: 88
Right 968258028 3:197297432-197297454 AATTAAGAACAGACAGAAGTCGG 0: 1
1: 0
2: 4
3: 30
4: 563

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968258028 Original CRISPR AATTAAGAACAGACAGAAGT CGG Intronic
900754054 1:4421181-4421203 AAAAAAAAACAGACAGAAGGAGG - Intergenic
902559508 1:17268098-17268120 CAGTAAGAACAGTCAGAAGTGGG + Intronic
902819380 1:18934438-18934460 AATTAAAAAGATACAGAAGGAGG - Intronic
902940030 1:19794206-19794228 ATTTGAGCACAGACAGAAGGAGG - Intronic
903481146 1:23654290-23654312 GAGGAAGAACTGACAGAAGTGGG + Intergenic
905774342 1:40658914-40658936 AATTAAGACAAGAGAGAAGCTGG + Intronic
906360040 1:45147898-45147920 AAATAAAAACAGAGAGATGTGGG + Intronic
906776633 1:48535628-48535650 AGTAGAGAACAGACAGAAGCAGG - Intronic
906964673 1:50444600-50444622 AATAAAGAACAGAGAGAGGAGGG - Intronic
907736995 1:57123260-57123282 TATTAAGAATTGACTGAAGTTGG - Intronic
908033427 1:60026437-60026459 AATAAAGAAAAGACAGAAGGAGG + Intronic
908282746 1:62559515-62559537 AATTAATAATGGACAAAAGTAGG - Intronic
908391179 1:63685016-63685038 AAAGAAGAAAAGAAAGAAGTGGG - Intergenic
908611260 1:65864352-65864374 ATTGAAGAATTGACAGAAGTAGG - Intronic
908819761 1:68073129-68073151 AATTGAGAACATACAATAGTTGG + Intergenic
908879648 1:68716433-68716455 AAATAAAAACAGAAAGAAGGAGG - Intergenic
909204267 1:72733584-72733606 AATTAATAATAGAGAGAAATGGG - Intergenic
909404438 1:75271549-75271571 AAGTAAGAACACACAGTATTTGG + Intronic
909821121 1:80062432-80062454 TATTAAGAAGAGACAGAGTTAGG + Intergenic
910204194 1:84731609-84731631 AATGAAAAACAGAAAAAAGTAGG - Intergenic
910337435 1:86150562-86150584 AATTAAGAAAAAAAAGAAGAAGG - Intronic
910343082 1:86210003-86210025 AGTTAAGAATAGAGGGAAGTGGG + Intergenic
911641879 1:100298234-100298256 AATAAAGAACAGATACAAGGAGG - Intergenic
911791558 1:102022320-102022342 AATGAAGCACAGAAAAAAGTAGG - Intergenic
912061261 1:105674035-105674057 AAGTAAGAACAGGTAGTAGTTGG + Intergenic
912392472 1:109313686-109313708 CATGCAGAACACACAGAAGTGGG + Exonic
914230411 1:145760798-145760820 ACTAAGGAACAGGCAGAAGTTGG + Intronic
915004291 1:152622517-152622539 TCTTAGGAACAGACACAAGTGGG - Intergenic
915047219 1:153028252-153028274 AAGTAAGAACATGCAGTAGTTGG + Intergenic
915990749 1:160513013-160513035 AAGGATGAACTGACAGAAGTAGG + Intronic
916140683 1:161694281-161694303 AATGACGAATTGACAGAAGTAGG + Intergenic
916237100 1:162601170-162601192 AATTCAGAAAATACAGAATTGGG + Intergenic
917575941 1:176321928-176321950 AATTAACAGGAGACAGAAGGAGG - Intergenic
917582239 1:176391044-176391066 ATGGAAGAACTGACAGAAGTAGG - Intergenic
917693035 1:177488639-177488661 AAGGAAGAATAGAGAGAAGTAGG + Intergenic
918400807 1:184161091-184161113 GATTACGAATAGACTGAAGTGGG + Intergenic
918534035 1:185554493-185554515 AACTAAGAACTAACAGGAGTAGG - Intergenic
918556475 1:185806239-185806261 AACTAATAAGAGACAGAAATGGG + Intronic
918945753 1:191062277-191062299 TTTGAAGAACTGACAGAAGTAGG - Intergenic
918956502 1:191215518-191215540 AATTGAGAACATACAGTATTTGG - Intergenic
918993168 1:191724660-191724682 AATTAAAGACAGAAAGAAATAGG + Intergenic
919672833 1:200353389-200353411 AATGAAGAAGAAACAGAAGCAGG - Intergenic
919957108 1:202428551-202428573 ATTTTAGAACAGATACAAGTAGG + Intronic
921806214 1:219458563-219458585 TTTTAAGTACAGAAAGAAGTTGG - Intergenic
921943293 1:220865949-220865971 AATTAATAACAGAAAGAAGTTGG - Intergenic
922371131 1:224911336-224911358 ACTGAATAACAGGCAGAAGTTGG - Intronic
922914618 1:229246500-229246522 AATTAATAAGAGAGAGATGTTGG - Intergenic
923326375 1:232883883-232883905 AATGAAGAACAGACAAAAATAGG - Intergenic
924131891 1:240918428-240918450 AATCAACAACAGAAAGAAGCTGG + Intronic
924333211 1:242961480-242961502 AATTAAGCACATGGAGAAGTAGG - Intergenic
924475120 1:244376083-244376105 AAATAAGAACAAGCAGAGGTGGG + Intronic
1063646258 10:7886343-7886365 AATGAAGAACATGCAGAAGGGGG - Intronic
1063705179 10:8423535-8423557 AAGTAAGAACATACAGTATTTGG - Intergenic
1064304427 10:14152582-14152604 CATTAAGAATAGAGAGAAGCCGG + Intronic
1064674265 10:17745778-17745800 AAAAAAAAATAGACAGAAGTAGG - Intergenic
1065668163 10:28085255-28085277 ACTGAAGCACAGAGAGAAGTAGG - Intronic
1066169127 10:32822242-32822264 AATTAAGAAAAGAAAGAAGGTGG - Intronic
1067308345 10:45088805-45088827 GAGTAAGAAGAGACAGAAGGGGG - Intergenic
1068180356 10:53510694-53510716 AATCAAGAACAGAAAGAAACAGG + Intergenic
1068844057 10:61650851-61650873 AATCATGAACAAACAAAAGTTGG - Intergenic
1068978784 10:63038712-63038734 AATGAAAAACAGAGAGAAGCTGG + Intergenic
1069098251 10:64286695-64286717 AATGAAACACAGACAGAAGCAGG - Intergenic
1069290825 10:66777721-66777743 AATAAAAAAGAGGCAGAAGTGGG + Intronic
1069467042 10:68650340-68650362 ACTTAAGAAGCCACAGAAGTAGG + Intronic
1069496812 10:68912146-68912168 AATTAGGAAAAGACTGAAATAGG + Intronic
1070732964 10:78844208-78844230 GGTTAAGAACAGACAGGAGCAGG + Intergenic
1070919555 10:80175754-80175776 AATTAAAAATACACAGATGTCGG + Intronic
1071681614 10:87711761-87711783 AATGAAGGACAGACAGAGGAAGG - Intronic
1072280534 10:93861772-93861794 AATTTAGAAAAGACACAACTTGG + Intergenic
1072944066 10:99793911-99793933 GATGAAGAACAGGCAGGAGTAGG - Exonic
1073224140 10:101902356-101902378 AGATATGAATAGACAGAAGTAGG + Intronic
1074028196 10:109658803-109658825 ATTTAAGAATAGACAGAAAAGGG - Intergenic
1074595618 10:114863160-114863182 AACAAAGAAAAAACAGAAGTGGG + Exonic
1074639095 10:115358854-115358876 AAATAATAATAGACATAAGTAGG - Intronic
1075093379 10:119455838-119455860 AAGGAAGAGCAGACAGAGGTGGG - Intronic
1075131485 10:119743562-119743584 AATGAAGGGCAGGCAGAAGTGGG + Intronic
1075150927 10:119930640-119930662 AATTAGGAATAGGGAGAAGTTGG + Intronic
1075661112 10:124197121-124197143 AATCATGAACAGAAAGAAATGGG - Intergenic
1077782755 11:5349395-5349417 AATTAAAAAAAAACAGGAGTAGG - Intronic
1077801470 11:5542865-5542887 AAGTAAGAACATACAGTATTTGG + Intronic
1078075825 11:8159505-8159527 TATTGAGAATAGACTGAAGTGGG + Intronic
1078219425 11:9339240-9339262 AATTAAAAACAAACAGCAGCCGG + Intergenic
1078724260 11:13914889-13914911 AATTAAAAAAAAATAGAAGTTGG - Intergenic
1079786897 11:24684608-24684630 AATCAATAACAGATAGAAATTGG + Intronic
1079794808 11:24788160-24788182 AATTAAAAACAAAAAGAAATAGG - Intronic
1079917098 11:26382652-26382674 GCTTGCGAACAGACAGAAGTGGG - Intronic
1080068909 11:28055198-28055220 CATTAAGAAAATACGGAAGTTGG - Intronic
1080341143 11:31266709-31266731 AATAAAGTAGGGACAGAAGTGGG - Intronic
1080479419 11:32630680-32630702 CATTAAGTACATTCAGAAGTGGG - Intronic
1080681931 11:34485674-34485696 AACTAGGAACAGACAGAACAGGG - Intronic
1080929815 11:36798086-36798108 ATTTAAAAACATATAGAAGTTGG - Intergenic
1081104582 11:39049199-39049221 CATTAAGATCAGAAAGAAGATGG + Intergenic
1082873575 11:57966056-57966078 AAATAAGAACACACAGTATTTGG + Intergenic
1083515109 11:63250141-63250163 ATTTAAGAACAGGCAAAATTGGG - Intronic
1084723181 11:70922781-70922803 AATAAAGAACAGGAAGATGTAGG + Intronic
1085689342 11:78652740-78652762 CATTAAGAACACACAGAGGCGGG + Intergenic
1086297435 11:85386366-85386388 AATTAATAAGTGACAGAACTAGG + Intronic
1086522544 11:87687087-87687109 AATTTAAAACAGAAAAAAGTAGG + Intergenic
1086854898 11:91854506-91854528 ATTCAAGAACAGAAAGAAGCAGG + Intergenic
1086917628 11:92548884-92548906 AATAAAGAAGTGAGAGAAGTTGG + Intronic
1087583733 11:100092272-100092294 AATTAAAAAGAAACAGCAGTGGG + Intronic
1088113045 11:106283919-106283941 ATTTGAGAACATACAGAAGGAGG - Intergenic
1088919359 11:114250276-114250298 AAGTGAGGACAGACAGAAGGCGG - Intronic
1089791231 11:120945686-120945708 TCTTGAGAACAAACAGAAGTGGG + Intronic
1090538450 11:127673224-127673246 ACTTAAGAATAGACAGAAGGTGG - Intergenic
1090618094 11:128534659-128534681 AAGTAAGAACAGACAGTGTTTGG + Intronic
1091056969 11:132428650-132428672 GATTAAGATCAGACAGACCTAGG + Intronic
1091431072 12:435112-435134 GATGAAAAACAGAAAGAAGTAGG - Intronic
1092520220 12:9264331-9264353 AATTGAGAACATCCAAAAGTGGG + Intergenic
1092556225 12:9564991-9565013 AATTCAGCACAAACAGAGGTCGG + Intergenic
1093038241 12:14353095-14353117 AATGAGTAACAGGCAGAAGTTGG - Intergenic
1094515867 12:31125661-31125683 AATTCAGCACAAACAGAGGTCGG - Intergenic
1095828838 12:46561264-46561286 AATTAAGAATAGAAATAAGTGGG + Intergenic
1096025213 12:48354854-48354876 AATGAAGAACACACATATGTGGG + Intergenic
1096228273 12:49883042-49883064 TCCTAAGAACAGACAGAGGTAGG + Intronic
1096967388 12:55639024-55639046 AAAAAAGAAAAGAAAGAAGTGGG - Intergenic
1097564059 12:61246204-61246226 AATTAAGCTCAGAAAAAAGTTGG - Intergenic
1098218156 12:68241312-68241334 AGTTAAAAACAGACAGTAGGAGG + Intergenic
1099060886 12:77906910-77906932 TATTAAGTAATGACAGAAGTTGG - Intronic
1099142090 12:78990813-78990835 AATTAACTTCATACAGAAGTTGG - Intronic
1099641298 12:85289101-85289123 AGTTGAAAACAGACAGAAATGGG - Intronic
1099850741 12:88092961-88092983 TGTTAAGAACAGACTGAAGGAGG + Intronic
1100403977 12:94257083-94257105 AATTAAGAAAAGATAGAACAGGG + Intronic
1100937568 12:99687523-99687545 AATGAAGTACAGAAAGAAGAAGG - Intronic
1101464461 12:104933827-104933849 AACTAAGAACATGCAGTAGTTGG - Intronic
1102104193 12:110306597-110306619 AAGTGAGAACAGACAGTATTTGG + Intronic
1102968877 12:117150080-117150102 AATTAACAACATAATGAAGTTGG + Intronic
1103633630 12:122284298-122284320 AAACAGGAACAGAGAGAAGTAGG + Intronic
1104129160 12:125876211-125876233 AAGTGAGAACAGACAGTATTTGG - Intergenic
1104223374 12:126807773-126807795 GAGTAAGAACAGACAGAATAGGG + Intergenic
1105303138 13:19152700-19152722 AATGATGCACAGACAGAGGTAGG + Intergenic
1105415103 13:20205168-20205190 AATTAAGAAACTACAGAATTAGG + Intergenic
1106077187 13:26470778-26470800 AAGTAAAAACATACAGTAGTTGG - Intergenic
1106849009 13:33768203-33768225 AAGTAAGAAGAGACTGAAGAGGG + Intergenic
1106877733 13:34093008-34093030 AATTCAGCACAGAAAGAAATGGG + Intergenic
1107140030 13:36988439-36988461 AAGCCAGAAAAGACAGAAGTAGG - Intronic
1107700814 13:43045807-43045829 AATTAAGCAGATAAAGAAGTAGG - Intronic
1107956463 13:45517732-45517754 AAGTAAGAACTGTCAGAAGCTGG - Intronic
1108128132 13:47267406-47267428 AATTGAGAAAAGACAGAGCTGGG + Intergenic
1108232910 13:48369079-48369101 CTTTAAGAACAGACAAAACTAGG - Intronic
1108282495 13:48873936-48873958 AATTAAGACCAGACTGGAGGTGG + Intergenic
1108940693 13:55948792-55948814 ATTGACGAACTGACAGAAGTAGG + Intergenic
1109318432 13:60780108-60780130 AATGAAAAACAGAAAAAAGTAGG - Intergenic
1109325632 13:60864297-60864319 AAGTAAGAACATACAGTATTTGG + Intergenic
1109346495 13:61120509-61120531 AATTAATAACAGACAAAAAAAGG + Intergenic
1109382909 13:61587767-61587789 GAATAAGAACAAGCAGAAGTAGG + Intergenic
1109434774 13:62284704-62284726 AACTAGGTACAGGCAGAAGTTGG - Intergenic
1109934656 13:69265193-69265215 AACTGAGTTCAGACAGAAGTGGG + Intergenic
1110583176 13:77156951-77156973 AATTAAAACCAGAAAAAAGTTGG + Intronic
1110777807 13:79431162-79431184 AACTAAAATCAGGCAGAAGTTGG - Intergenic
1111194377 13:84854174-84854196 AACCAAGAATAGACTGAAGTTGG + Intergenic
1111210012 13:85065487-85065509 AATTAAGAACAATCAGATGAAGG - Intergenic
1111579856 13:90208511-90208533 AATTAATAAGAGACAGACCTTGG - Intergenic
1112222851 13:97508697-97508719 AAGTAAGAACATACAGGACTTGG + Intergenic
1112737053 13:102431883-102431905 AATTAAGAAATGAGAGAAGGAGG - Intergenic
1112740511 13:102467780-102467802 ATGGAAGCACAGACAGAAGTGGG + Intergenic
1114543208 14:23479018-23479040 GATTAAAAAAAGATAGAAGTTGG + Intronic
1114583906 14:23791901-23791923 AATTAAGAATACTCAGAAATAGG + Intergenic
1115794191 14:36914553-36914575 AATAAACAAAACACAGAAGTTGG - Intronic
1115947601 14:38679753-38679775 AAGTGAGAACATACAGAATTTGG + Intergenic
1116252923 14:42509901-42509923 AATTGAGAACATGCAGAATTTGG - Intergenic
1117033452 14:51700773-51700795 AACTAAGAAAAAGCAGAAGTTGG + Intronic
1117479111 14:56125533-56125555 AAGTAAAAACCGAAAGAAGTGGG - Intronic
1117932070 14:60854291-60854313 ATTGATGAACTGACAGAAGTAGG - Intronic
1118001046 14:61523995-61524017 ATTTCAAAACAGACAAAAGTAGG - Intronic
1118761259 14:68881487-68881509 GATGAATAACAGACAGAAATGGG - Intronic
1118858465 14:69642792-69642814 AATAATGATCAGAAAGAAGTGGG - Intronic
1118926876 14:70199263-70199285 ATTGATGAACTGACAGAAGTAGG - Intergenic
1119393586 14:74308853-74308875 AAAAAAAAACAAACAGAAGTTGG - Intronic
1119570843 14:75670349-75670371 AATTCACAACAGACAAAAGGTGG - Intronic
1120395996 14:83967795-83967817 AAGTAAGAACATACAGTATTTGG - Intergenic
1120719315 14:87873139-87873161 AATTAGGAGAAGAGAGAAGTAGG + Intronic
1121802791 14:96788821-96788843 AATGAGGAACAGAGAGAAGAAGG - Intergenic
1121958210 14:98234124-98234146 AAATAAGACCAGACAAAAGCAGG + Intergenic
1122188598 14:100021841-100021863 AATTGAGAGCAGACAGAAGCAGG + Intronic
1123691208 15:22839628-22839650 AAAGAAGAAAACACAGAAGTAGG - Intronic
1125157692 15:36607618-36607640 AATGAAGGAAAGACAGAAGAAGG - Intronic
1125655555 15:41353989-41354011 AATAAAGAAACGACAGAATTTGG + Intronic
1126074581 15:44896925-44896947 AATTAATAACAGATAAAACTTGG + Intergenic
1126083777 15:44990898-44990920 AATTAATAACAGATAAAACTTGG - Intergenic
1126829013 15:52580146-52580168 AAGTGAGAACAGACAGACGCTGG + Intergenic
1127160004 15:56172434-56172456 AAATAAGAAAATAAAGAAGTAGG + Intronic
1127352456 15:58166991-58167013 ATTTAACAAGAGACAGAAATGGG + Intronic
1128710824 15:69870337-69870359 AATTAATAAAATACAGCAGTTGG + Intergenic
1129084637 15:73075940-73075962 AATTCAAAACAGACAAAAATAGG - Intronic
1129481293 15:75828495-75828517 GATTAAGAAATGAAAGAAGTTGG - Intergenic
1130132077 15:81152250-81152272 AATAAAAAACAGCTAGAAGTAGG - Intergenic
1130571190 15:85045411-85045433 AATTAAATTCAGACAGAACTGGG + Intronic
1130751802 15:86720396-86720418 CATTAAGAACAAAAATAAGTTGG - Intronic
1131363504 15:91817168-91817190 AATTCAGAACAGACACAACATGG + Intergenic
1133174072 16:4000587-4000609 CAGTAAGAACAGACAGCAGATGG + Intronic
1135245718 16:20855314-20855336 AATTAAGCACAGACGGAGCTGGG + Exonic
1135461212 16:22644842-22644864 AAGTAAGAACAGGCAGTATTTGG + Intergenic
1137877968 16:52015366-52015388 AATTGAAAACAGGCAGAAGCAGG + Intronic
1138403107 16:56765076-56765098 TATTAAGAACAGAAACAAGATGG - Intronic
1138933064 16:61685124-61685146 AATTGAGAATAGAGAGAAGTTGG + Intronic
1139326738 16:66158367-66158389 AATAAAAATCAAACAGAAGTGGG - Intergenic
1139874122 16:70131555-70131577 AATAAAGAAAAGTCAGAATTGGG - Intronic
1140361654 16:74349584-74349606 AATAAAGAAAAGTCAGAATTGGG + Intergenic
1140855756 16:78976277-78976299 AATAAAGATCAGAAAGAAGTAGG - Intronic
1141903528 16:87007946-87007968 AATTAGGAACAAAAAGAACTGGG + Intergenic
1143228334 17:5327747-5327769 ATTTAAAAATAGACAAAAGTAGG + Intronic
1144196850 17:12902714-12902736 AATTAGGAAGTGACAGAACTGGG - Intronic
1144957866 17:19028576-19028598 AGTTCAGAACCAACAGAAGTGGG - Intronic
1144977292 17:19145944-19145966 AGTTCAGAACCAACAGAAGTGGG + Intronic
1145095804 17:20024980-20025002 GATTGTGAACACACAGAAGTAGG - Intronic
1145727090 17:27139819-27139841 AAGTAAGAACATACAGTATTTGG - Intergenic
1147356798 17:39904810-39904832 AGTTAGGAAGAGACAGAGGTAGG + Exonic
1148255591 17:46128769-46128791 AAATAAAAGCAGACAGAACTTGG + Intronic
1148635572 17:49146609-49146631 AATTAAGAAAAGACAGTGTTGGG - Intronic
1148774949 17:50090029-50090051 AATTCTGGACAGACAGATGTTGG + Intronic
1149112457 17:53049494-53049516 AATGACTAACAGACAGAGGTTGG - Intergenic
1149289298 17:55200575-55200597 AATTAATAAGGGGCAGAAGTAGG + Intergenic
1150961681 17:69920098-69920120 AATTAAGAACATGCAGTATTTGG - Intergenic
1151299963 17:73217015-73217037 AATTAAGAAGAGAAAGCATTTGG - Intronic
1151857705 17:76734718-76734740 AATTAAAAACCTACAAAAGTTGG - Exonic
1153339713 18:3961376-3961398 AATTCAGTACAGAAAGAAGTGGG - Intronic
1153359878 18:4182227-4182249 AATTAAGAACAAGCAGAAGCAGG + Intronic
1153845977 18:9050248-9050270 ACTGGATAACAGACAGAAGTTGG + Intergenic
1154324261 18:13378761-13378783 AATTAACAACAGAGAGAAACAGG - Intronic
1154419142 18:14208317-14208339 AATTTTGAACAAACAGAATTAGG - Intergenic
1154928915 18:20972028-20972050 TATTAAGATCAGACAGTAGGGGG + Intronic
1156097754 18:33556184-33556206 ATATATGAACAGACAGAAATGGG - Intergenic
1156578454 18:38347571-38347593 GACTAAGAACACAAAGAAGTTGG - Intergenic
1156718924 18:40046282-40046304 AATTGAAAACAGACAAAAGGTGG + Intergenic
1156849914 18:41714212-41714234 CATTAAAAACAGGCAGATGTAGG + Intergenic
1157491790 18:48128612-48128634 AAGTGAGAACATACAGAATTTGG - Intronic
1158217573 18:55116023-55116045 AATTAAGAAAAGACTTGAGTTGG + Intergenic
1158234236 18:55295140-55295162 GATGAAGAACAGAAAGAATTAGG - Intronic
1158349844 18:56554048-56554070 AATAAAGAACTGACAGAAATAGG - Intergenic
1159667780 18:71184094-71184116 GATCAAGAGGAGACAGAAGTAGG + Intergenic
1159718893 18:71859952-71859974 ACTGAATAACAGGCAGAAGTTGG - Intergenic
1160956962 19:1698298-1698320 AAATAAGAAGAGAAGGAAGTTGG + Intergenic
1161040216 19:2106633-2106655 AATTCACAACAGCCAGAAGGTGG + Intronic
1164015862 19:21255548-21255570 AAGAAAGAACAAACAGAAGTAGG + Intronic
1164436170 19:28231621-28231643 AAACAATGACAGACAGAAGTTGG - Intergenic
1165702341 19:37948161-37948183 AATTGAGAACAAGCAGCAGTAGG + Intronic
1167633258 19:50638930-50638952 AATTAGGAACAGACAGACCAGGG + Intronic
1167680245 19:50915637-50915659 AGAGAAGAACAGACAGAAGTGGG + Intergenic
1168484209 19:56747303-56747325 AATTGAGATCACACAGAAATCGG + Intergenic
925267503 2:2576492-2576514 AATGAAGAACAGAGAGGAGGTGG + Intergenic
925598940 2:5588451-5588473 TACAAAGAACAGAGAGAAGTGGG - Intergenic
925743362 2:7024973-7024995 TAGTGAGGACAGACAGAAGTGGG + Intronic
926073117 2:9917140-9917162 TGTTAAGAACAGAAAGGAGTCGG - Intronic
926147195 2:10404011-10404033 AATAAAGAACAAACAGAATATGG - Intronic
926791218 2:16573963-16573985 ACTTGATAACAGACAGAGGTTGG + Intronic
927049822 2:19316273-19316295 AAATGAGAACATACAGTAGTTGG + Intergenic
927312399 2:21646088-21646110 AAATAGCAAAAGACAGAAGTAGG - Intergenic
927536697 2:23867343-23867365 AATTCAGAAATGACAGAATTTGG - Intronic
927650137 2:24907697-24907719 AATTAAGAATAGACAAGACTGGG + Intronic
927660171 2:24986750-24986772 TATCAAGAATAGACAGAAGTAGG + Intergenic
928639792 2:33285893-33285915 AAGTAAGAACACTAAGAAGTTGG - Intronic
929279136 2:40059291-40059313 AAGTAAGAACATACAGTATTTGG - Intergenic
930156038 2:48108489-48108511 AATTAAGAAAAGAAGGAAATGGG + Intergenic
930331226 2:49987155-49987177 AAGTAAGAATAGGGAGAAGTTGG - Intronic
930487767 2:52028969-52028991 AAATAAAAAAAGACAAAAGTAGG - Intergenic
930510042 2:52333265-52333287 AATTTATAACAGAGAAAAGTTGG + Intergenic
930989190 2:57630458-57630480 AATTAAGCTCAGTTAGAAGTTGG + Intergenic
931584616 2:63811843-63811865 AAGTAAGAACATACAGTATTTGG + Intronic
931892730 2:66692371-66692393 AATAAAGGACATACAGAAGCGGG + Intergenic
935007544 2:99094741-99094763 AATTAAAAACCAACAGATGTTGG + Intronic
935440726 2:103092780-103092802 AATTAAAAACAGAAAAAAGCAGG - Intergenic
935852386 2:107236445-107236467 ACTGACGAACTGACAGAAGTAGG + Intergenic
936524323 2:113232627-113232649 AATTAACAGCTGACAGTAGTTGG + Intronic
936660402 2:114536703-114536725 CATGAAGAACAGACCAAAGTTGG - Intronic
936735779 2:115441499-115441521 AAATATGAATAGGCAGAAGTAGG - Intronic
937542033 2:122967873-122967895 AATTAATAACATGAAGAAGTGGG - Intergenic
937945269 2:127329035-127329057 ATTGAAGAACAGACAGAATGGGG + Intronic
938150901 2:128881662-128881684 AATTAAGAACATCAAAAAGTGGG + Intergenic
938224163 2:129601573-129601595 ATTGAAGAATTGACAGAAGTAGG - Intergenic
938723849 2:134089659-134089681 ACTTAAGCACAGCCAGGAGTTGG - Intergenic
939043393 2:137220508-137220530 AATAAAGAACAGAAAGAAACTGG + Intronic
939070264 2:137531025-137531047 ATTTAACAACAGAAAGATGTAGG - Intronic
939085445 2:137713452-137713474 AGTTAAGAAAAGAGAGAAGAAGG + Intergenic
939277754 2:140022564-140022586 AATAAAGAAAAGACAGAAGTGGG + Intergenic
941190341 2:162373662-162373684 CCTACAGAACAGACAGAAGTAGG + Exonic
941307516 2:163889740-163889762 AAATAGGAACAGACAGTTGTGGG + Intergenic
941467634 2:165848620-165848642 AATTAAAAAAAAACAGATGTTGG - Intergenic
942033170 2:171984016-171984038 AAGTAAGAACATACAGTATTTGG + Intronic
942290464 2:174464805-174464827 AATTCAGCACAAACAGAAGATGG - Intronic
942374408 2:175322368-175322390 ATTTAAAAACAGATAAAAGTTGG - Intergenic
942530452 2:176904356-176904378 AAATGAGAACAGACAGTATTTGG - Intergenic
942888221 2:180955070-180955092 AATTAAGAACAGTAAGATTTGGG + Intergenic
942924212 2:181412257-181412279 ATTGATGAATAGACAGAAGTAGG + Intergenic
943456065 2:188108758-188108780 AAGTAAGAACATACAGTATTTGG - Intergenic
943769785 2:191704070-191704092 AATAAAAATAAGACAGAAGTGGG + Intergenic
944336043 2:198536552-198536574 AAGTAAGAACATACAGTATTTGG - Intronic
945066749 2:205954043-205954065 AATGAAGAATAGAGAGAAATGGG + Intergenic
945171229 2:206997549-206997571 AAAAAAGAAGAGACAGAATTGGG + Intergenic
945268939 2:207919427-207919449 TCTTAAGAACAGACTGAAGGGGG + Intronic
945331554 2:208545688-208545710 ACTTAAGCAAAGACAGAAGCTGG + Intronic
945566518 2:211407335-211407357 AACTAAGAAGAGACTGTAGTAGG + Intronic
946636228 2:221730540-221730562 AAGTAAGAACATACAGTATTTGG - Intergenic
946825931 2:223677909-223677931 AGTTAAAAACTGACAGAAATAGG + Intergenic
946933835 2:224699050-224699072 CAATGAGAACAGACAGAACTGGG + Intergenic
947311437 2:228808307-228808329 ATTGAAGAATTGACAGAAGTAGG - Intergenic
947370213 2:229438129-229438151 AATGAAGCAAAGACAGAAGAAGG + Intronic
947768722 2:232654217-232654239 AAAAAAGAAAAGAAAGAAGTTGG + Intronic
947929109 2:233948686-233948708 AATTAACAACCCACAGTAGTGGG + Intronic
947966846 2:234289306-234289328 AATAAAGTATTGACAGAAGTTGG - Intergenic
948723326 2:239917202-239917224 AATTAAAAAGAGAAAGAAATAGG + Intronic
1169928273 20:10805763-10805785 CATTAAGAGCAGCCAGAAGCAGG - Intergenic
1170413829 20:16119545-16119567 AAGTAAGAACATACAGTACTTGG - Intergenic
1170797940 20:19565944-19565966 AATAACCAACATACAGAAGTTGG - Intronic
1170994482 20:21338527-21338549 AATGGAGAAAAGAGAGAAGTGGG - Intronic
1171491397 20:25520891-25520913 TCTTAAAAACAGCCAGAAGTGGG - Intronic
1172072342 20:32267396-32267418 AATTAAAAACGGACAAAAGCTGG - Intergenic
1173300188 20:41795664-41795686 AATACAGAACGGACAGAAGAAGG - Intergenic
1173357731 20:42310056-42310078 AGTGAAGAAAAGACAGATGTAGG + Intronic
1173483054 20:43418097-43418119 AAGTAAGAACATACAGTATTTGG + Intergenic
1175255327 20:57642073-57642095 AATGAAGAAAAGAAAAAAGTCGG + Intergenic
1176854167 21:13950970-13950992 AATTTTGAACAAACAGAATTAGG + Intergenic
1177858393 21:26424969-26424991 AGTTAAGAACAGACTGACGTGGG + Intergenic
1178718020 21:34984554-34984576 AAGGAAGAAGAGAAAGAAGTTGG + Intronic
1178908773 21:36657592-36657614 AAATAAGAACAGGCAGTAGTTGG - Intergenic
1179546712 21:42117354-42117376 TATTTATAACAGACAGAAGGCGG - Intronic
1180204750 21:46252161-46252183 AATTAAGAACAAGTAGAAGCCGG - Intronic
1181261265 22:21599541-21599563 ACTTAAGACCAAACAGAAGCAGG + Intronic
1181547604 22:23611363-23611385 AAATAAGAACAGCCATAAATTGG - Intronic
1182601392 22:31467522-31467544 AATTAAGAATTGCCAGAACTAGG + Intronic
1182723158 22:32420562-32420584 AGTTAAGAAGAGGCAGAAATGGG - Intronic
1182794410 22:32980331-32980353 GGTATAGAACAGACAGAAGTTGG + Intronic
1183807741 22:40226245-40226267 AATTAAGAGCATTGAGAAGTAGG + Intronic
1184532460 22:45064914-45064936 AATTAAAGACAGACACACGTAGG + Intergenic
1184623942 22:45707384-45707406 ATTTACAAACAAACAGAAGTTGG + Intronic
949688133 3:6601384-6601406 AAATAAGAACAGGCACGAGTGGG - Intergenic
949811744 3:8013614-8013636 CATTAAGATGAGACAGAATTTGG + Intergenic
951013840 3:17707232-17707254 AATTAACAATAAAAAGAAGTGGG - Intronic
951380620 3:21979927-21979949 AAGTAAGAAGAGGCAGAATTAGG - Intronic
951416384 3:22428190-22428212 AATTAAAAACAAAAAGGAGTTGG + Intergenic
951733089 3:25832614-25832636 TACTAAGAACTGACATAAGTAGG - Intergenic
952616003 3:35274854-35274876 AATTAAAAACAGAAAAAAATAGG + Intergenic
953266490 3:41394246-41394268 AATTAAAAACAGACAGCAGAAGG + Intronic
953896984 3:46810526-46810548 AAATAAGAACAGACAGGAAAGGG + Intronic
954516118 3:51178830-51178852 AAATAAGTACAGAGAGAATTTGG + Intronic
954517216 3:51189496-51189518 AAGTAAGAACATACAGTATTTGG + Intronic
955104284 3:55881981-55882003 AATAAAGACCAGACTGAAGAAGG + Intronic
955287658 3:57658629-57658651 AATAAAAAACAGATAGCAGTAGG - Intronic
955352196 3:58202069-58202091 AATTAAAAAAAGAAAGAAGAGGG - Intronic
955562544 3:60207465-60207487 AATTCAGAACAAACAGGATTAGG - Intronic
955710740 3:61776470-61776492 AATTAACAACAGACACAAACGGG - Intronic
955905656 3:63804938-63804960 AATTAATAACATACAGTAGAAGG + Intergenic
956042514 3:65159422-65159444 AATTAATAACAGCCAAAAGGTGG - Intergenic
957025314 3:75174583-75174605 AATTAAGAACTGTCAGATGTTGG + Intergenic
957169125 3:76714690-76714712 AATTAACACCAGACTTAAGTAGG + Intronic
957441635 3:80255339-80255361 AATTAATAATAAACAGAAGGAGG - Intergenic
958586900 3:96098850-96098872 TAGAAAAAACAGACAGAAGTTGG + Intergenic
958831998 3:99100617-99100639 AATTAAGAGCAGTGAGATGTTGG - Intergenic
959788672 3:110331542-110331564 AAATAAGAACATACAGTATTTGG - Intergenic
959865006 3:111256741-111256763 AAATAACAAGAGACAGAAATTGG - Intronic
959978210 3:112485391-112485413 AATTCAGAACAGGCAGAAAAGGG - Intronic
960078768 3:113517775-113517797 AACAAAGAAAAGAGAGAAGTAGG + Intergenic
960227185 3:115182395-115182417 AAGTAAGAACATACAGTATTAGG - Intergenic
960645214 3:119872936-119872958 AATTAAGCAGAGACAGAGATTGG - Intronic
960718208 3:120598664-120598686 AATAAAGATCTGAAAGAAGTGGG + Intronic
960767798 3:121156483-121156505 AATAAAGTACATACAGAACTTGG - Intronic
961097856 3:124173381-124173403 AACAAAGGACAGACAGAATTGGG + Intronic
961185311 3:124910049-124910071 AATCAAGAAAATAGAGAAGTGGG - Intronic
961493239 3:127271190-127271212 AATTAAGCACAGTGAGAAATTGG - Intergenic
962613378 3:137100620-137100642 AATTGAGAACAGGCAGTATTTGG - Intergenic
962993211 3:140598662-140598684 AATTTGAAGCAGACAGAAGTAGG - Intergenic
963170902 3:142250422-142250444 ATTATAGAACAGACAGAAGAGGG + Intergenic
963380851 3:144528480-144528502 AATTAAAAACAAAGAGAAGAAGG - Intergenic
963645740 3:147911992-147912014 AAGCAAAAACAGACAGAAATGGG + Intergenic
963667390 3:148206112-148206134 GATTAAGAGCAGCCAAAAGTAGG - Intergenic
964163223 3:153671010-153671032 GATTGAGAAAAGACAGAAGTAGG + Intergenic
964654777 3:159054176-159054198 AATTAAAAACACATAAAAGTAGG + Intronic
964681849 3:159349585-159349607 AAATAAGAACAGATTGTAGTAGG - Intronic
964874939 3:161356638-161356660 AATAAAGAATAAGCAGAAGTGGG - Intronic
965471166 3:169094249-169094271 ATTTAAGAACAGAAAAAATTTGG - Intronic
965939677 3:174163666-174163688 AATTGAGAACACACAGTATTTGG + Intronic
965996349 3:174886960-174886982 AATAAACAACAGACAAACGTGGG + Intronic
966502641 3:180661430-180661452 ACTAAAGAAAAGACAGAAATAGG + Intronic
966652226 3:182314626-182314648 AAGGATGAACTGACAGAAGTAGG - Intergenic
967143009 3:186579233-186579255 AGTTAAGAGCAGACAGAAGTAGG - Intronic
968258028 3:197297432-197297454 AATTAAGAACAGACAGAAGTCGG + Intronic
969283440 4:6187128-6187150 AAGCAAAAACTGACAGAAGTGGG - Intronic
970290775 4:14569727-14569749 AAGTAAGAACATACAGTATTTGG + Intergenic
971316701 4:25573646-25573668 GATTAAAAACAGGCAGTAGTTGG - Intergenic
971529912 4:27674132-27674154 AAATGAGAAGAGACACAAGTTGG - Intergenic
971938431 4:33184805-33184827 AACTAAAAACAAACACAAGTTGG - Intergenic
972128869 4:35803684-35803706 AATCAAAATCAGACTGAAGTGGG + Intergenic
972132121 4:35850863-35850885 ATTTAAGAACAGACATAAGGAGG - Intergenic
972854638 4:43091889-43091911 AAATAAGAATAAAGAGAAGTTGG + Intergenic
974017712 4:56663907-56663929 AATTAAGAACAAAATGAAATTGG + Intronic
974252161 4:59400206-59400228 GATTAAGAAGAAATAGAAGTTGG - Intergenic
974628231 4:64451422-64451444 AATAAAGAACAGACTAAAATAGG - Intergenic
975513826 4:75222463-75222485 TTTGAAGAACTGACAGAAGTAGG + Intergenic
975729965 4:77328150-77328172 ACCTGAGAACAGACAGACGTTGG - Intronic
977400638 4:96527115-96527137 ATTTAAGAACAGAGAGAAGAAGG + Intergenic
978013626 4:103718656-103718678 GATGAGGAACAGACAGAAGAGGG + Intronic
978210631 4:106131705-106131727 ACTGAGTAACAGACAGAAGTTGG + Intronic
979138943 4:117148245-117148267 AAGTGAGAACAGACAGTATTTGG + Intergenic
979177747 4:117685299-117685321 AATTTACAAAAGAAAGAAGTTGG - Intergenic
979452820 4:120892763-120892785 AGCTAAGTTCAGACAGAAGTGGG + Intronic
980152635 4:129067037-129067059 AGTTAAGAACTGACACAATTGGG + Intronic
981046701 4:140271392-140271414 GATTAGGAGGAGACAGAAGTTGG + Intronic
981376151 4:144018289-144018311 CATGAGGAACAGACAGAACTGGG - Intronic
981386665 4:144139633-144139655 CATGAGGAACAGACAGAACTGGG - Intronic
981427946 4:144625609-144625631 AATTAAAGACACACAGAAGCTGG + Intergenic
981641956 4:146954898-146954920 AATTAGGAGCAGAGAGAATTTGG - Intergenic
981766639 4:148258333-148258355 AATTAAGGAAAGAGAGAAGGAGG + Intronic
981877515 4:149565431-149565453 AAATATGAAAAGACAGAACTGGG - Intergenic
982521094 4:156417515-156417537 ACTGGAGAACAGACAGAGGTTGG - Intergenic
983391976 4:167143527-167143549 AATCAAGAAAATACAGTAGTTGG - Intronic
983853349 4:172611005-172611027 AATGAAAAACAGAAAGAAGCAGG - Intronic
983967245 4:173827913-173827935 TATTAAAAACAAACAGAAGGGGG - Intergenic
985167639 4:187114248-187114270 AATTAAGAATTGACAGAAATTGG + Intergenic
985220846 4:187702957-187702979 GATAAAGAACAAACAGCAGTTGG - Intergenic
985523442 5:389867-389889 AATGAAGAAAAGACAGAGGCAGG + Intronic
985860584 5:2467515-2467537 TATAAAGAACAGAGAGAAGTGGG - Intergenic
986189651 5:5483290-5483312 AATTAAGAATAGACAGTGGCCGG - Intronic
986348006 5:6852488-6852510 AATTAAGAACCTAGAGAAGAGGG + Intergenic
986583833 5:9294156-9294178 AAATAAGACCAGACAGCATTTGG + Intronic
986761562 5:10884520-10884542 AATTAACAAAAAAAAGAAGTAGG + Intergenic
987260489 5:16197255-16197277 AACTGAGAACAGGCAGAGGTTGG - Intergenic
987431643 5:17842341-17842363 AATTAAAAACAGAAAAAAGCAGG - Intergenic
988094112 5:26580690-26580712 AATTAAGAATATACAGTATTTGG + Intergenic
988356917 5:30188926-30188948 AGATATGAACAGACAGAAATAGG - Intergenic
988670402 5:33375320-33375342 AATTAATAAATAACAGAAGTAGG - Intergenic
988967091 5:36430306-36430328 AATAAAAAACAGAAAGAAGCAGG - Intergenic
989144376 5:38234307-38234329 ACTGAGTAACAGACAGAAGTTGG + Intergenic
989315774 5:40076818-40076840 AATTAGGTTCAGACACAAGTAGG + Intergenic
989792223 5:45419660-45419682 AAAGAAGATCAGACAGAAGAAGG + Intronic
990648719 5:57874063-57874085 AGTTAAGAACAGAAATAGGTTGG - Intergenic
991325162 5:65423075-65423097 AATTCAGAACATACAGTATTTGG - Intronic
992331677 5:75723317-75723339 AAGTAAGAACACACAGTATTTGG + Intergenic
993193762 5:84713181-84713203 AAATGAGAACAGGCAGAAATAGG - Intergenic
993433968 5:87868032-87868054 AATTAAGAGAAATCAGAAGTAGG + Intergenic
993790356 5:92200409-92200431 AGTTAAGAACTGAAAGAAGGTGG - Intergenic
993904606 5:93608978-93609000 AATTAACAACACACAGAGCTCGG + Intergenic
993969549 5:94401308-94401330 TATTAAGAATAGAAACAAGTGGG + Intronic
994152779 5:96468136-96468158 AAATAAGAACATACAGCATTTGG - Intergenic
994901114 5:105770684-105770706 AATTAAGAAAATTCAAAAGTAGG + Intergenic
995011493 5:107261085-107261107 AATGAGTAACAGACAGAGGTTGG - Intergenic
995300703 5:110577778-110577800 AAGTAAGAACAGGCAGTATTTGG - Intronic
995601400 5:113800959-113800981 AATTTAGCAAAGACAGAACTAGG + Intergenic
995927981 5:117398725-117398747 GATTAAGAACAAACAAAAGACGG - Intergenic
996242640 5:121222082-121222104 ATTGAAGAATTGACAGAAGTAGG + Intergenic
997664817 5:135621579-135621601 GCTTAAGAACAGACTCAAGTGGG + Intergenic
998661225 5:144240331-144240353 AATGAAGAAGAGAAAGAAGAAGG - Intronic
999056030 5:148577725-148577747 AAGTAAGAACAGGCAGTATTTGG - Intronic
999348068 5:150841766-150841788 AATTAAAAAATGACAGATGTTGG - Intergenic
1001069574 5:168573270-168573292 AATTAAGAAAAAAGAAAAGTTGG + Intronic
1001449175 5:171810842-171810864 AATGCAGAACAGTCAGAAGGCGG - Intergenic
1002777827 6:343494-343516 AAATAAGAACAGACCAGAGTGGG - Intronic
1003262630 6:4534424-4534446 AAGTAAGAACATACAGTATTTGG - Intergenic
1005140728 6:22628475-22628497 AAGTAAGAACATACAGTATTTGG + Intergenic
1005957016 6:30671328-30671350 AATTAGGAACAGAGCTAAGTGGG - Intronic
1006047536 6:31309561-31309583 AATGAAGATCACACAAAAGTAGG - Intronic
1006209079 6:32377203-32377225 TGTTAAGAAAAGACAGTAGTGGG + Intergenic
1006310276 6:33252764-33252786 AATGTAGCACAGACAGAAGATGG + Intronic
1007126843 6:39432817-39432839 AAATAATAACAGACAGTAGAGGG + Intronic
1007447745 6:41920306-41920328 AATTAGAAACAGACACAAGCGGG + Intronic
1007856724 6:44865317-44865339 CCTGAATAACAGACAGAAGTTGG - Intronic
1009338844 6:62528377-62528399 AATTAATAAAAGAAAGAAGTTGG + Intergenic
1009664992 6:66664972-66664994 AATTCATAATAGACAGAAATAGG + Intergenic
1010263395 6:73841419-73841441 TAATAAGAACACACAGAAGATGG - Intergenic
1010398802 6:75425024-75425046 CAATTAGAAGAGACAGAAGTTGG - Intronic
1010898038 6:81390573-81390595 ACATAAGAAAAGACAGAAGTAGG + Intergenic
1011013214 6:82725373-82725395 AATTCAGAACAGAGTTAAGTGGG - Intergenic
1011169333 6:84488734-84488756 AATTGAGAACAGAGTGAAGGGGG + Intergenic
1011608701 6:89129568-89129590 AATTAGAAACAGAGAGAAGAGGG - Intergenic
1012646190 6:101684987-101685009 AATTGAGAAGACACAGAAGCAGG - Intronic
1013066902 6:106692903-106692925 AATTAAAAACAAATAGAGGTGGG - Intergenic
1013130602 6:107229178-107229200 AACTAAAAACAAACAGAAATAGG - Intronic
1014541505 6:122681613-122681635 AATTAAGAAAAAACAAAACTTGG + Intronic
1014546071 6:122737363-122737385 AATTAAGAAAAGATAAAACTTGG + Intergenic
1014607271 6:123492507-123492529 TATTAAGCCCAGATAGAAGTTGG + Intronic
1014934128 6:127366310-127366332 AAATAACAAGAGACAGTAGTTGG - Intergenic
1015891390 6:137973206-137973228 AATTAAGAGAAGAAAGAAGAGGG + Intergenic
1016371505 6:143379350-143379372 AATGAAGAACAGACATCGGTGGG + Intergenic
1017191238 6:151654843-151654865 AATGAAGCACTGACAGGAGTGGG + Intergenic
1018153410 6:160962146-160962168 AATTTAGAACAGACCAGAGTAGG - Intergenic
1018310655 6:162504870-162504892 AATTGAGGAAAGACAGAACTAGG + Intronic
1019001172 6:168753697-168753719 AAGAAAGAACAGACAGAACCTGG + Intergenic
1019867183 7:3722768-3722790 ACCTAAGAACAGACAGAGGGCGG - Intronic
1020545239 7:9520202-9520224 AAGTAAGAACATACAGTATTTGG - Intergenic
1020602771 7:10296658-10296680 AATTGAGAATAGACAGAAAGCGG - Intergenic
1021905047 7:25324814-25324836 AAATATGAACAGACAGTATTTGG + Intergenic
1023075936 7:36482941-36482963 AGCTAAGTTCAGACAGAAGTGGG + Intergenic
1023107994 7:36782107-36782129 AGCTGAGAGCAGACAGAAGTTGG + Intergenic
1023314507 7:38921434-38921456 AAAAAAGAACAGACAGCAGCAGG + Intronic
1023520716 7:41047570-41047592 AAGAAAGAAAAGAAAGAAGTGGG + Intergenic
1023826913 7:44015681-44015703 ATTTAACAAGAGAAAGAAGTAGG - Intergenic
1024128751 7:46327752-46327774 AATTAAAAACAGAAACAATTGGG + Intergenic
1024355956 7:48413405-48413427 ACTTAACAACAGGCAGAAATAGG + Intronic
1026249367 7:68655150-68655172 AATTAATAACAGAAATAAATTGG + Intergenic
1026317979 7:69243841-69243863 AAATAAGAACAGGCAGCATTTGG + Intergenic
1027366018 7:77458751-77458773 TTTTAAGAACAGATTGAAGTGGG + Intergenic
1027460794 7:78450982-78451004 AAGTAAGAAAAGACAGAAAGCGG + Intronic
1027959312 7:84923696-84923718 AATTAAAAACATACTCAAGTTGG - Intergenic
1028342250 7:89735876-89735898 AATTAAAAACAAACAGATGCAGG - Intergenic
1028715654 7:93964348-93964370 AAGTAAGAACATACAGTATTTGG + Intronic
1028740065 7:94264013-94264035 AAATAAGAAAAGATAGAATTAGG + Intergenic
1028838894 7:95404843-95404865 AATTAAACACAGACAAAACTGGG + Intergenic
1028853064 7:95558318-95558340 AATTTAGAACTGAAGGAAGTGGG + Intergenic
1029699279 7:102235836-102235858 AATTAAGAACTGACAGGCCTGGG - Intronic
1029738065 7:102475432-102475454 ATTTAACAAGAGAAAGAAGTAGG - Intronic
1029755200 7:102569082-102569104 ATTTAACAAGAGAAAGAAGTAGG - Intronic
1029773148 7:102668162-102668184 ATTTAACAAGAGAAAGAAGTAGG - Intronic
1030378828 7:108787677-108787699 AACTAAGAACAGGCAGTATTTGG - Intergenic
1030473281 7:109995596-109995618 AAAGAAGAAAAGACAGAAGAAGG + Intergenic
1030692059 7:112546441-112546463 ATTGATGAACTGACAGAAGTAGG - Intergenic
1031159274 7:118146400-118146422 AATTGAGAATAGACATAAGAGGG - Intergenic
1031186478 7:118487235-118487257 AATTAAAAAAAGATAGATGTTGG + Intergenic
1031357896 7:120811010-120811032 AATTAAGAAGGGAAAGAATTTGG + Intronic
1032568538 7:132974283-132974305 TATTACTAACAGACAGAAGAAGG - Intronic
1032937414 7:136749033-136749055 AAATGAGAACAAACAGAAATGGG - Intergenic
1033006624 7:137571843-137571865 AAGCAAGAAAAGACAGAAGAAGG + Intronic
1033463189 7:141565855-141565877 GATTAGGAACAGGCAAAAGTAGG - Intronic
1033483519 7:141764871-141764893 AAGTAAGAAGAGAAAGAAGAAGG - Exonic
1033575389 7:142677810-142677832 AATAAACAACAGAAAGAAGCTGG - Intergenic
1033724491 7:144099456-144099478 AATTAAGATAAGACAAAAGTAGG + Intergenic
1034118659 7:148607386-148607408 AATTAAGAAGAAACAGATGCAGG - Intronic
1034575700 7:151995060-151995082 AATTATGAAGAGAAAGAAATGGG - Intronic
1035600693 8:895138-895160 ATTTCAGAACAGCCAGAAGAGGG + Intergenic
1036493398 8:9248527-9248549 AATTACAAACATACAGGAGTCGG - Intergenic
1037028060 8:14064160-14064182 CATTAAGTAGAGACAGAAGGAGG - Intergenic
1038191713 8:25327640-25327662 AGTTAAGAACATTCAGAAGATGG - Intronic
1039114106 8:34073074-34073096 AGGTAAGAACAGAAAAAAGTGGG - Intergenic
1039151835 8:34515249-34515271 ATTTAAGAAAAAACAGAAGCTGG + Intergenic
1039636843 8:39177010-39177032 AATGAAAAACAGAAAAAAGTTGG - Intronic
1041477170 8:58279295-58279317 ACACAGGAACAGACAGAAGTTGG - Intergenic
1041975599 8:63795667-63795689 AATTAAGATATGACAGAAGAAGG - Intergenic
1042234679 8:66599298-66599320 AATTAAGAAAAAACATAATTGGG - Intronic
1042581407 8:70283034-70283056 AATTCAGTACAGACAGAGCTTGG + Intronic
1043033657 8:75169916-75169938 AATTGGTAACAGGCAGAAGTTGG - Intergenic
1043146057 8:76656514-76656536 AATTGACCACAGACAAAAGTTGG + Intergenic
1045526782 8:102947414-102947436 AATAAATAAGAGACTGAAGTAGG + Intronic
1045753439 8:105513260-105513282 ATATAAGAAAAGACAGAAGCTGG - Intronic
1046366682 8:113241073-113241095 AATAAAGAAAAGAGAAAAGTGGG - Intronic
1046409520 8:113821396-113821418 AAGTAAGAACATGCAGAATTTGG - Intergenic
1046604669 8:116357905-116357927 ACTTTGGAACAGAAAGAAGTGGG + Intergenic
1050837304 9:10098683-10098705 CATTAAAAACTGACTGAAGTAGG - Intronic
1051586361 9:18731228-18731250 TTTTAAGATCAGACAGATGTTGG + Intronic
1051948313 9:22599244-22599266 AATTCAGAACAGACAGATGTTGG + Intergenic
1051952430 9:22652327-22652349 AATGAAAAACAGAGAGAAGTGGG - Intergenic
1051983041 9:23046843-23046865 ATTGACGAACTGACAGAAGTTGG + Intergenic
1051999839 9:23265434-23265456 AATTAAGTAGAGAAAGAAATAGG + Intergenic
1052127879 9:24801024-24801046 AATAAGAAAAAGACAGAAGTAGG - Intergenic
1052404477 9:28042219-28042241 ATTTAAGAACAGACATGATTAGG + Intronic
1052405703 9:28057824-28057846 AGTTAACTACACACAGAAGTAGG - Intronic
1052606754 9:30713757-30713779 AATTAGGCACAGAAAGGAGTTGG - Intergenic
1052889065 9:33679634-33679656 AATAAACAACAGAAAGAAGCTGG - Intergenic
1052968249 9:34359101-34359123 AATTAATAACAGAAGGAAGTTGG - Intergenic
1054973209 9:71113239-71113261 AACTAGGAATAGACAGAAGGGGG + Intronic
1055320439 9:75078821-75078843 AAATAACAATAGCCAGAAGTGGG - Intronic
1056388834 9:86121655-86121677 AATTTTGAAGAGACACAAGTCGG + Intergenic
1057055816 9:91959868-91959890 TATTAAGAACAGAGAGAAGCAGG - Intergenic
1057218898 9:93245031-93245053 GATTCAGAAGAGACATAAGTGGG - Intronic
1058198676 9:102010623-102010645 AATGAAAAACAGAAAAAAGTAGG + Intergenic
1058404326 9:104654807-104654829 AATATAAAACAGACAAAAGTAGG + Intergenic
1058734354 9:107880549-107880571 AGTGAACAAGAGACAGAAGTGGG - Intergenic
1058763434 9:108159050-108159072 GAATAAGAACAGAGAGATGTTGG - Intergenic
1058841130 9:108910496-108910518 AATGAAGAACTGACAGCAATGGG + Intronic
1059088989 9:111335443-111335465 CTTTAAGAGCTGACAGAAGTAGG + Intergenic
1059866241 9:118517318-118517340 AATTAAGAAGACACAGATATAGG - Intergenic
1059885332 9:118739146-118739168 ATTTAAGAAAAGAAAGAAATAGG - Intergenic
1061120690 9:128640628-128640650 AAACAAGAGGAGACAGAAGTGGG + Intronic
1061893654 9:133635778-133635800 AATTGAGAGGAGACAAAAGTGGG + Intergenic
1203459902 Un_GL000220v1:25410-25432 ATTGAAGAATTGACAGAAGTAGG - Intergenic
1185469159 X:372324-372346 AAATATCAACAGAAAGAAGTGGG + Intronic
1186244255 X:7604234-7604256 AATTAAAAAAATACAGATGTTGG + Intergenic
1186416762 X:9390405-9390427 AATAAAAAATAGACAGAAATGGG + Intergenic
1187486714 X:19711135-19711157 GCTTAAGAACAGTCAGATGTGGG - Intronic
1187718906 X:22131538-22131560 AAATAAGAACAAACAGCAGATGG - Intronic
1188259817 X:28009071-28009093 ACTGAATAACAGACAGAGGTTGG - Intergenic
1188567523 X:31543870-31543892 AATGAACAACAGTAAGAAGTAGG + Intronic
1192662264 X:73053521-73053543 ACTGAAGAACTGACAGAGGTAGG + Intergenic
1193786301 X:85763494-85763516 AATTAAGAAGAGTCAGAATATGG + Intergenic
1193830136 X:86279668-86279690 TTTTATGAACTGACAGAAGTAGG + Intronic
1194113146 X:89862424-89862446 AATTAATAACAGAAAAAAATTGG - Intergenic
1194127860 X:90042107-90042129 AATAAAGAAGAGACCCAAGTGGG + Intergenic
1194602727 X:95942339-95942361 AAATAAGAACAGAAAGATATTGG - Intergenic
1194796039 X:98211811-98211833 ATTTAAGATCACACAGAAGAAGG + Intergenic
1195970289 X:110465471-110465493 CATTAAGGACAGAGAAAAGTGGG - Intergenic
1196070586 X:111516862-111516884 TGTTAACAACAGACAGAACTAGG + Intergenic
1196976553 X:121164020-121164042 AATTAAAAAAAGACATATGTAGG - Intergenic
1197305404 X:124835184-124835206 TTTAAAGGACAGACAGAAGTTGG - Intronic
1197541797 X:127772375-127772397 ACTTAAAAACATACAGCAGTGGG - Intergenic
1197999599 X:132419300-132419322 GATTGAGAACCGATAGAAGTAGG + Intronic
1198482491 X:137053483-137053505 CATTAAGAACACAGAGAAGGGGG - Intergenic
1199400377 X:147391762-147391784 AATTAAAAACAGAAAAAAGCAGG + Intergenic
1199659402 X:150033113-150033135 AATTAAGAACAGCTAGGGGTAGG + Intergenic
1199757539 X:150879351-150879373 AATTAAGAAAAGGGAGAAGGTGG + Intronic
1199850033 X:151719374-151719396 AATGATTAACAGAGAGAAGTTGG + Intronic
1199885237 X:152014604-152014626 AAATGAGCATAGACAGAAGTGGG + Intergenic
1200324440 X:155223187-155223209 AATTAAAAAAAGAAAGAAATAGG - Intronic
1200354005 X:155528567-155528589 AAGTAAGAACATACAGTATTTGG + Intronic
1200465832 Y:3517480-3517502 AATTAATAACAGAAAAAAATTGG - Intergenic
1201256776 Y:12115449-12115471 AAGGAAGAACAAACAGAAATTGG + Intergenic
1201292021 Y:12429750-12429772 AGTTCAAAACAGTCAGAAGTGGG - Intergenic
1202330721 Y:23749697-23749719 TTTTAGGAATAGACAGAAGTAGG + Intergenic
1202391585 Y:24375889-24375911 AATTAAGCACATGGAGAAGTAGG + Intergenic
1202479200 Y:25294228-25294250 AATTAAGCACATGGAGAAGTAGG - Intergenic
1202540048 Y:25920364-25920386 TTTTAGGAATAGACAGAAGTAGG - Intergenic
1202576758 Y:26335998-26336020 ATTTTAGAACAGATACAAGTAGG - Intergenic