ID: 968258202

View in Genome Browser
Species Human (GRCh38)
Location 3:197298035-197298057
Sequence TGGGGCGTGCGGCAGCAACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 106}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968258202 Original CRISPR TGGGGCGTGCGGCAGCAACT GGG (reversed) Intronic
900414367 1:2528292-2528314 GGGAGTGTGCAGCAGCAACTCGG + Intergenic
901167581 1:7230982-7231004 TGGAGGGTGTGGCAGCAAATAGG + Intronic
902058048 1:13618639-13618661 TGGGGCGTCCCCCAGCAACAGGG - Intergenic
902819973 1:18937838-18937860 TGGGGTGCTCGGCAGCATCTGGG - Intronic
903498377 1:23787501-23787523 TGGGGCTTGCTGCAGAAACCTGG + Exonic
905455767 1:38087034-38087056 TGGGGAGTGGGGAAGCCACTGGG + Intergenic
906724434 1:48033681-48033703 TGGGGGCTGCAGCAGCAGCTGGG + Intergenic
910288240 1:85577257-85577279 TGGTGGCTGCGGCAGGAACTGGG - Intronic
915510619 1:156385027-156385049 TGGGGAGTGGGGCCGTAACTGGG + Exonic
922913774 1:229239242-229239264 TGGGGCCTGTGGCAGCGCCTAGG + Intergenic
1063695643 10:8332543-8332565 TGAGGAGAGCGGCAGCATCTCGG + Intergenic
1064339998 10:14477303-14477325 TGGGGCATGTGCCAGCTACTTGG + Intergenic
1069910069 10:71753608-71753630 TGAGGCAAGCGGCAGCAACTTGG - Intronic
1070793167 10:79201732-79201754 TGGGGCGGGCTGCAGCAGCAGGG + Intronic
1071201440 10:83223463-83223485 TGGGCCCTGCAGCAGCATCTAGG + Intergenic
1075300786 10:121322242-121322264 TGGGACGTGGGGCAGCACCCTGG - Intergenic
1076380648 10:130022664-130022686 TGGGATGTGCGGCAGCAAAGGGG - Intergenic
1076756431 10:132574918-132574940 TGGGGCGTGAGGCAGCTGGTAGG + Intronic
1085254781 11:75166133-75166155 TGGGGAGTGCGGTAGGAAGTAGG + Intronic
1087652034 11:100879092-100879114 TGGGGCCAGCAGCATCAACTAGG + Intronic
1088349278 11:108866406-108866428 TGGGGCGGGCTGGAGCAGCTTGG + Intronic
1090375078 11:126282865-126282887 TGGGGCGGTCCGCAGCAACTCGG - Intergenic
1091623352 12:2105976-2105998 TGGGGCGTCCTGAAGCCACTGGG + Intronic
1091623371 12:2106030-2106052 TGGGGCGTCCTGAAGCCACTGGG + Intronic
1091623446 12:2106296-2106318 TGGGGCGTCCTGAAGCCACTGGG + Intronic
1091623564 12:2106669-2106691 TGGGGCGTCCTGAAGCCACTGGG + Intronic
1091623645 12:2106935-2106957 TGGGGCGTCCTGAAGCCACTGGG + Intronic
1103202020 12:119095502-119095524 TGGGGTGTGCAGCAGCAGCATGG - Intronic
1104968971 12:132522656-132522678 TGGGGCGTGCAGCAGGAGCAGGG - Intronic
1106734766 13:32577901-32577923 TGGCTCGAGCTGCAGCAACTGGG - Intergenic
1108667710 13:52649463-52649485 TGGCGCGTGCCTCAGCTACTTGG - Intergenic
1114661300 14:24346899-24346921 TTGGGCCTGAGGCAGCCACTTGG + Intergenic
1117156839 14:52950684-52950706 CGGGGCTTTCGGCAGAAACTCGG + Intronic
1121397072 14:93635112-93635134 GGGGGTGTGCGGCTGCAACCTGG - Intronic
1122399728 14:101459340-101459362 CGGGGCGGGCGGCAGCAGGTGGG + Intergenic
1122643378 14:103175655-103175677 TGCGCCCTGCGGCAGCATCTGGG - Intergenic
1123577946 15:21691578-21691600 TGGGGAGAATGGCAGCAACTTGG + Intergenic
1123614571 15:22134060-22134082 TGGGGAGAATGGCAGCAACTTGG + Intergenic
1124956715 15:34365095-34365117 TGGAGTGTGGGGCAGCAACAAGG + Exonic
1129223834 15:74153854-74153876 TTGGGCATGGGGCAGCAGCTGGG - Intergenic
1129256837 15:74338614-74338636 TGGGGTGTGCGGCAGTGTCTGGG - Exonic
1202986816 15_KI270727v1_random:425823-425845 TGGGGAGAATGGCAGCAACTTGG + Intergenic
1132502355 16:290177-290199 TGGGGGGTGCGAGAGCAACCAGG - Intronic
1132834902 16:1947862-1947884 AGGGGCGTGGGCCAGCACCTGGG + Intronic
1136566688 16:31074609-31074631 TGGGGCGCGCGGCTGCAGTTAGG + Exonic
1136628043 16:31473571-31473593 TGGGGACTGGGGCAGCCACTAGG + Intronic
1144205619 17:12977641-12977663 TGGGGCGTAGGGCGGCTACTAGG - Intronic
1144707436 17:17378875-17378897 TGGGACCTGCAGCAGCACCTGGG - Intergenic
1146232823 17:31129230-31129252 TGGGGAGAAAGGCAGCAACTTGG - Intronic
1146439055 17:32877322-32877344 TGGGCCGGGCGGCGGCAGCTGGG + Intergenic
1148870803 17:50657966-50657988 TGGGGCAGGAGGCAGCACCTGGG - Intronic
1149519280 17:57306121-57306143 TGGGGGTTGGGGAAGCAACTGGG + Intronic
1152557871 17:81063530-81063552 GGGGTTGTGCGGCAGCCACTTGG + Intronic
1157610247 18:48951182-48951204 GGGGGCGTCCGGCTGGAACTGGG + Intergenic
1160772634 19:839881-839903 TGGGGCGTACGGCATAAACCCGG - Intergenic
1163250820 19:16125335-16125357 TGGGGAGGGCGGCAGCTAATGGG + Intronic
1164724494 19:30457165-30457187 TGGGGCCTGTGGGAGCACCTTGG + Intronic
1167621906 19:50565449-50565471 TGGGGGCTGCGTCTGCAACTGGG + Intronic
1168056859 19:53869082-53869104 CGGGGCTTGCGGGAGCACCTGGG - Intronic
925274770 2:2641005-2641027 AGGGGTGTGGGGCAGGAACTGGG + Intergenic
925420130 2:3704331-3704353 AGGGGCGTGGGGCAGAAACAGGG + Intronic
932489350 2:72110183-72110205 TGGGGCCTGTGGCAGCACCCGGG - Intergenic
937539021 2:122925666-122925688 TGGGGCCTGCAGCAGCATCCAGG + Intergenic
938942426 2:136180865-136180887 TGGGCCCTGCAGCAGCATCTAGG + Intergenic
939580225 2:143937852-143937874 TGGAGCGTGCAGCTGCAATTTGG - Intergenic
944868167 2:203882491-203882513 GGGGGCATGCGCCAGCAACTCGG + Intergenic
946832060 2:223737110-223737132 TGGGGTGTGGGGCAGGCACTTGG + Intergenic
1173934115 20:46846255-46846277 TGGAGGGTGTGGCAGCCACTTGG + Intergenic
1176358181 21:5969973-5969995 TGGGGCTTGGGGGAGCCACTTGG + Intergenic
1179708010 21:43193738-43193760 CCGGGCGTTCAGCAGCAACTTGG + Intergenic
1179765337 21:43568578-43568600 TGGGGCTTGGGGGAGCCACTTGG - Intronic
1179934090 21:44591469-44591491 GAGGCCGTGCGGCAGCAGCTGGG + Exonic
1179940795 21:44638069-44638091 GAGGCCGTGCGGCAGCAGCTGGG - Exonic
1181626048 22:24123004-24123026 TGGGGAATGGTGCAGCAACTGGG - Intronic
1182420557 22:30246616-30246638 TGCGGGGCGCGGCGGCAACTTGG - Intronic
1183272556 22:36871227-36871249 TGGGGCCTGCGGCTGCCACATGG - Intronic
950118478 3:10466464-10466486 TGGGGTGTGAGGAAGCAATTAGG + Intronic
954389555 3:50261440-50261462 TGGGGGGTGGGGGAGCAGCTAGG + Intergenic
960926400 3:122798923-122798945 TGGGGCGTGAGGCAGCACAAAGG - Intronic
965963183 3:174453328-174453350 TGGGGAGTATGGAAGCAACTTGG + Intronic
968258202 3:197298035-197298057 TGGGGCGTGCGGCAGCAACTGGG - Intronic
970756099 4:19428796-19428818 CGGGCCCTGCGGCAGCATCTGGG + Intergenic
971043221 4:22778143-22778165 TCGGGCCAGCAGCAGCAACTGGG - Intergenic
974284675 4:59848525-59848547 TGCAGGGTGAGGCAGCAACTTGG + Intergenic
977693897 4:99946658-99946680 GGGGGCGTGCGGCGGCAGCGGGG + Exonic
985672508 5:1213741-1213763 TGGGGCCTGGGGCAGCTCCTGGG + Intronic
985716474 5:1466056-1466078 TGGGGATTGCGGCATCCACTGGG + Intronic
992493455 5:77268488-77268510 GGGGGGGTGGGGCAGGAACTGGG - Intronic
995224653 5:109689629-109689651 GGGGGCGGGCGGCGGCAACGCGG - Exonic
998449427 5:142222869-142222891 TGGGGTGGGTGGCAGCGACTGGG - Intergenic
999924604 5:156361087-156361109 TGGGGCCTGCAGCAGCACCCAGG - Intronic
1000279937 5:159773575-159773597 CGGGGCGCGCGGCAGCAGCCAGG + Intergenic
1002597231 5:180332157-180332179 TGGGTTGTGCGGCAGGAACTGGG - Intronic
1007105214 6:39279126-39279148 TGGAGGGTGTGGCAGCAGCTGGG + Intergenic
1009543407 6:64995085-64995107 TGGGGCATGCTGCATCAGCTTGG + Intronic
1018909994 6:168096387-168096409 TTGGGCGCGCAGCAGCCACTGGG + Intergenic
1021576485 7:22110009-22110031 TGGGGTGTGGGGCAGGAACAGGG + Intergenic
1023460717 7:40393471-40393493 TGGGACTTGAGGCAGCAAGTAGG + Intronic
1033654147 7:143362129-143362151 GGGGGCGTGCGAAAGAAACTCGG + Intronic
1033883558 7:145916938-145916960 TGGGCCCTGTGGCAGCATCTAGG - Intergenic
1035730255 8:1849483-1849505 GGGGGCGTGGGGCAGCCACGTGG + Intronic
1038157202 8:25001368-25001390 TGGTGCCTGCGGTAGTAACTAGG - Intergenic
1040683526 8:49842539-49842561 TGGGCCTTGCGGCAGCAACTTGG - Intergenic
1042695770 8:71553937-71553959 TGGGTCGTGTCGCAGCAACTCGG + Intronic
1049527021 8:143132170-143132192 TAGGACGTGAGGCAGCACCTCGG + Intergenic
1051552167 9:18342087-18342109 TCGGGCTTGAGGCAGCAAGTGGG - Intergenic
1058829314 9:108800968-108800990 TGGGCCCTGCAGCAGCATCTAGG - Intergenic
1059447727 9:114349203-114349225 GGGGGCGTGAGTCAGCCACTTGG + Intronic
1059746469 9:117206500-117206522 TGTACCGTGCTGCAGCAACTTGG - Intronic
1189395838 X:40622041-40622063 TGAGGCGTGCGGCTGTAAATTGG - Intergenic
1191075048 X:56443950-56443972 TGGGGAGAGTGGAAGCAACTTGG - Intergenic
1198186105 X:134255546-134255568 AGTGGCGTGCAGCAGCAACTGGG - Intergenic
1200102192 X:153693763-153693785 TGGGTCGTGCGGCAGGGGCTGGG - Intronic
1200787612 Y:7273942-7273964 TGGGGCGGGCGGAAGCAGCCTGG - Intergenic