ID: 968258928

View in Genome Browser
Species Human (GRCh38)
Location 3:197303185-197303207
Sequence TACCATTTCAGTATTCAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968258928_968258932 24 Left 968258928 3:197303185-197303207 CCCTGCTGAATACTGAAATGGTA No data
Right 968258932 3:197303232-197303254 GAATTCGTTCTACCCAGTTTTGG No data
968258928_968258933 27 Left 968258928 3:197303185-197303207 CCCTGCTGAATACTGAAATGGTA No data
Right 968258933 3:197303235-197303257 TTCGTTCTACCCAGTTTTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968258928 Original CRISPR TACCATTTCAGTATTCAGCA GGG (reversed) Intergenic
No off target data available for this crispr