ID: 968262155

View in Genome Browser
Species Human (GRCh38)
Location 3:197334235-197334257
Sequence AAGTCTACTCACCCCAACGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968262152_968262155 -6 Left 968262152 3:197334218-197334240 CCCTATGCAGCTAAGTGAAGTCT No data
Right 968262155 3:197334235-197334257 AAGTCTACTCACCCCAACGGAGG No data
968262153_968262155 -7 Left 968262153 3:197334219-197334241 CCTATGCAGCTAAGTGAAGTCTA No data
Right 968262155 3:197334235-197334257 AAGTCTACTCACCCCAACGGAGG No data
968262149_968262155 22 Left 968262149 3:197334190-197334212 CCGCTTGGCTTACAAACTGCCTT No data
Right 968262155 3:197334235-197334257 AAGTCTACTCACCCCAACGGAGG No data
968262150_968262155 3 Left 968262150 3:197334209-197334231 CCTTTCTTCCCCTATGCAGCTAA No data
Right 968262155 3:197334235-197334257 AAGTCTACTCACCCCAACGGAGG No data
968262151_968262155 -5 Left 968262151 3:197334217-197334239 CCCCTATGCAGCTAAGTGAAGTC No data
Right 968262155 3:197334235-197334257 AAGTCTACTCACCCCAACGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968262155 Original CRISPR AAGTCTACTCACCCCAACGG AGG Intergenic
No off target data available for this crispr