ID: 968264543

View in Genome Browser
Species Human (GRCh38)
Location 3:197352676-197352698
Sequence CTGCAGACACAGCGGGGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968264543_968264553 21 Left 968264543 3:197352676-197352698 CCCTGCCCCCGCTGTGTCTGCAG No data
Right 968264553 3:197352720-197352742 CCTCTTTCTCCACTGAAGGAAGG No data
968264543_968264551 17 Left 968264543 3:197352676-197352698 CCCTGCCCCCGCTGTGTCTGCAG No data
Right 968264551 3:197352716-197352738 GAGACCTCTTTCTCCACTGAAGG No data
968264543_968264550 -8 Left 968264543 3:197352676-197352698 CCCTGCCCCCGCTGTGTCTGCAG No data
Right 968264550 3:197352691-197352713 GTCTGCAGGAGCAATGATTGAGG No data
968264543_968264556 28 Left 968264543 3:197352676-197352698 CCCTGCCCCCGCTGTGTCTGCAG No data
Right 968264556 3:197352727-197352749 CTCCACTGAAGGAAGGAGTGGGG No data
968264543_968264555 27 Left 968264543 3:197352676-197352698 CCCTGCCCCCGCTGTGTCTGCAG No data
Right 968264555 3:197352726-197352748 TCTCCACTGAAGGAAGGAGTGGG No data
968264543_968264554 26 Left 968264543 3:197352676-197352698 CCCTGCCCCCGCTGTGTCTGCAG No data
Right 968264554 3:197352725-197352747 TTCTCCACTGAAGGAAGGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968264543 Original CRISPR CTGCAGACACAGCGGGGGCA GGG (reversed) Intergenic
No off target data available for this crispr