ID: 968265105

View in Genome Browser
Species Human (GRCh38)
Location 3:197356679-197356701
Sequence GTGAAGAACACAGAGGTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968265098_968265105 4 Left 968265098 3:197356652-197356674 CCGACTTTCCCCGCACAGGGAGA No data
Right 968265105 3:197356679-197356701 GTGAAGAACACAGAGGTGGGTGG No data
968265099_968265105 -4 Left 968265099 3:197356660-197356682 CCCCGCACAGGGAGAGAAAGTGA No data
Right 968265105 3:197356679-197356701 GTGAAGAACACAGAGGTGGGTGG No data
968265100_968265105 -5 Left 968265100 3:197356661-197356683 CCCGCACAGGGAGAGAAAGTGAA No data
Right 968265105 3:197356679-197356701 GTGAAGAACACAGAGGTGGGTGG No data
968265101_968265105 -6 Left 968265101 3:197356662-197356684 CCGCACAGGGAGAGAAAGTGAAG No data
Right 968265105 3:197356679-197356701 GTGAAGAACACAGAGGTGGGTGG No data
968265093_968265105 30 Left 968265093 3:197356626-197356648 CCCACGACTCTTAGGAGACGGGC No data
Right 968265105 3:197356679-197356701 GTGAAGAACACAGAGGTGGGTGG No data
968265097_968265105 5 Left 968265097 3:197356651-197356673 CCCGACTTTCCCCGCACAGGGAG No data
Right 968265105 3:197356679-197356701 GTGAAGAACACAGAGGTGGGTGG No data
968265094_968265105 29 Left 968265094 3:197356627-197356649 CCACGACTCTTAGGAGACGGGCA No data
Right 968265105 3:197356679-197356701 GTGAAGAACACAGAGGTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968265105 Original CRISPR GTGAAGAACACAGAGGTGGG TGG Intergenic
No off target data available for this crispr