ID: 968268680

View in Genome Browser
Species Human (GRCh38)
Location 3:197382671-197382693
Sequence CACATCAAGGAGAAGATGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968268680_968268688 21 Left 968268680 3:197382671-197382693 CCTTCCATCTTCTCCTTGATGTG No data
Right 968268688 3:197382715-197382737 CTCAGAAAGGAAAGGGAACGAGG No data
968268680_968268683 -9 Left 968268680 3:197382671-197382693 CCTTCCATCTTCTCCTTGATGTG No data
Right 968268683 3:197382685-197382707 CTTGATGTGAGAATATCCATAGG No data
968268680_968268687 14 Left 968268680 3:197382671-197382693 CCTTCCATCTTCTCCTTGATGTG No data
Right 968268687 3:197382708-197382730 ACAGAAACTCAGAAAGGAAAGGG No data
968268680_968268686 13 Left 968268680 3:197382671-197382693 CCTTCCATCTTCTCCTTGATGTG No data
Right 968268686 3:197382707-197382729 GACAGAAACTCAGAAAGGAAAGG No data
968268680_968268685 8 Left 968268680 3:197382671-197382693 CCTTCCATCTTCTCCTTGATGTG No data
Right 968268685 3:197382702-197382724 CATAGGACAGAAACTCAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968268680 Original CRISPR CACATCAAGGAGAAGATGGA AGG (reversed) Intergenic
No off target data available for this crispr