ID: 968273626

View in Genome Browser
Species Human (GRCh38)
Location 3:197423590-197423612
Sequence CTGCCTCTCTTTCCTAGTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968273626_968273631 4 Left 968273626 3:197423590-197423612 CCAGAACTAGGAAAGAGAGGCAG No data
Right 968273631 3:197423617-197423639 GCTCAGGACCCGAGGAGGGATGG No data
968273626_968273636 28 Left 968273626 3:197423590-197423612 CCAGAACTAGGAAAGAGAGGCAG No data
Right 968273636 3:197423641-197423663 CTCCCAGAACCAGGAAAGAGAGG No data
968273626_968273629 -1 Left 968273626 3:197423590-197423612 CCAGAACTAGGAAAGAGAGGCAG No data
Right 968273629 3:197423612-197423634 GCTGTGCTCAGGACCCGAGGAGG No data
968273626_968273630 0 Left 968273626 3:197423590-197423612 CCAGAACTAGGAAAGAGAGGCAG No data
Right 968273630 3:197423613-197423635 CTGTGCTCAGGACCCGAGGAGGG No data
968273626_968273628 -4 Left 968273626 3:197423590-197423612 CCAGAACTAGGAAAGAGAGGCAG No data
Right 968273628 3:197423609-197423631 GCAGCTGTGCTCAGGACCCGAGG No data
968273626_968273635 19 Left 968273626 3:197423590-197423612 CCAGAACTAGGAAAGAGAGGCAG No data
Right 968273635 3:197423632-197423654 AGGGATGGGCTCCCAGAACCAGG No data
968273626_968273632 5 Left 968273626 3:197423590-197423612 CCAGAACTAGGAAAGAGAGGCAG No data
Right 968273632 3:197423618-197423640 CTCAGGACCCGAGGAGGGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968273626 Original CRISPR CTGCCTCTCTTTCCTAGTTC TGG (reversed) Intergenic
No off target data available for this crispr