ID: 968276723

View in Genome Browser
Species Human (GRCh38)
Location 3:197445954-197445976
Sequence GACCCTGATGCAACCACAGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968276717_968276723 25 Left 968276717 3:197445906-197445928 CCTTAATTTTGAAAATTTGGTTG No data
Right 968276723 3:197445954-197445976 GACCCTGATGCAACCACAGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968276723 Original CRISPR GACCCTGATGCAACCACAGC GGG Intergenic
No off target data available for this crispr