ID: 968279695

View in Genome Browser
Species Human (GRCh38)
Location 3:197466972-197466994
Sequence CAGGCCCCCGCACTTGCTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 131}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968279695 Original CRISPR CAGGCCCCCGCACTTGCTGG TGG Intergenic
900311545 1:2035782-2035804 CAGGCCCCCACGCTGACTGGGGG + Intergenic
900311563 1:2035830-2035852 CAGGCCCCCACGCTGACTGGGGG + Intergenic
900633200 1:3649642-3649664 CTGGGCCCCGCACCTGCTTGGGG + Intronic
900633211 1:3649672-3649694 CTGGGCCCCGCACCTGCTTGGGG + Intronic
900695483 1:4006875-4006897 CAGGCCCACTCACTTGCTGTCGG + Intergenic
901639475 1:10686113-10686135 CAGGCCCCCGTGCTGGGTGGGGG - Intronic
904400986 1:30256605-30256627 CAGGGCCCTCCAGTTGCTGGAGG + Intergenic
906034888 1:42744267-42744289 CAGGTTCCCTAACTTGCTGGAGG + Intergenic
907138239 1:52159204-52159226 CAGGCCCTGGCACAAGCTGGTGG - Intronic
907906130 1:58784633-58784655 CACCCCCCCGCACTTCCGGGGGG + Intergenic
908171000 1:61504627-61504649 CAGGCACCAGCTCTGGCTGGGGG - Intergenic
912659147 1:111513116-111513138 CAGGCCACCTCAGTTGCTGCAGG + Intronic
917274086 1:173312201-173312223 GAGGCTCCCGCAGTTGCTAGTGG - Intergenic
917968917 1:180195057-180195079 CAGGCGCCTGCACTTGGTCGTGG + Intronic
919944946 1:202312150-202312172 CAGGGCCCCCCACTTCCTGTGGG + Intronic
923665950 1:235998889-235998911 CAGGCCACAGCACTGGTTGGTGG + Intronic
923665956 1:235998926-235998948 CAGGCCACAGCACTGGTTGGTGG + Intronic
923771463 1:236941611-236941633 CAGTCCCTCACTCTTGCTGGGGG + Intergenic
1063216899 10:3932870-3932892 CAGGCCGCCGAGTTTGCTGGTGG + Intergenic
1063368560 10:5506735-5506757 CAGGCACCCGCAGCTCCTGGTGG - Intergenic
1063450041 10:6145041-6145063 CAGGTCCCCGCGCGCGCTGGGGG - Intronic
1067479094 10:46583957-46583979 CAGGGCCCAGCACCTGCTGGCGG + Intronic
1067571555 10:47375336-47375358 CAAGCCCCCGCACCGGCAGGTGG - Intronic
1067615645 10:47757844-47757866 CAGGGCCCAGCACCTGCTGGCGG - Intergenic
1069712860 10:70500994-70501016 CAGGAGCCCCCACCTGCTGGTGG - Intronic
1070290085 10:75108369-75108391 CAGAGCCCCGCACTTTCTGGTGG + Intronic
1070688831 10:78509800-78509822 CAGGCCCCTGCACTTGCTCCTGG - Intergenic
1073097441 10:100988390-100988412 CATGCCCCCGCAAATACTGGCGG - Exonic
1073186425 10:101617989-101618011 CAGGCCCCTGCACAAGGTGGGGG + Intronic
1075504575 10:123010546-123010568 CAGGCCCTCTCACTTCCTAGTGG + Intronic
1076885632 10:133261210-133261232 CAGGCCACTGCACTTGCAGAGGG - Intergenic
1077256580 11:1586799-1586821 CAGGCACCCACACCTGCAGGAGG - Intergenic
1077387154 11:2275446-2275468 AAGGCCCCCCCACTTCCAGGCGG - Intergenic
1077411676 11:2406648-2406670 CAGGCCCCCGCACCTGTGGGCGG + Exonic
1078334171 11:10450883-10450905 CCGGCCCCCGCGCCTGCTGCGGG + Exonic
1079034909 11:17013447-17013469 CAGGCCCGCGCAGTGGATGGAGG + Intronic
1084775301 11:71370844-71370866 CAGCCCCCAGCCCTGGCTGGAGG + Intergenic
1085523493 11:77151477-77151499 CAGGCCTGGGCACTTCCTGGAGG + Intronic
1090260643 11:125316270-125316292 CAGGCCCCGGCACTGGATGGAGG - Intronic
1092072337 12:5641669-5641691 CAGTTCCCGGAACTTGCTGGTGG + Intronic
1097428603 12:59475328-59475350 CAGGACCCCCCAATTGCTGTTGG - Intergenic
1102017158 12:109655598-109655620 ATGGCCCCCCCACTTGCTGAAGG + Intergenic
1103125175 12:118415771-118415793 CAGTCCCCCCAACTTGCTTGGGG - Exonic
1103415180 12:120738484-120738506 CAGGCCCGCGCCCCGGCTGGCGG + Intronic
1103477188 12:121227411-121227433 GAGGCCGGCGCACCTGCTGGCGG + Intronic
1103733270 12:123042605-123042627 CAGGCCCCCAGACCTGCCGGTGG - Intronic
1104990445 12:132621343-132621365 CAGGTGCCTGCACCTGCTGGGGG + Exonic
1106175184 13:27324129-27324151 CAGGAACTCTCACTTGCTGGTGG + Intergenic
1106314799 13:28583845-28583867 CATGCCCACTCACTTGCTGGGGG + Intergenic
1106568348 13:30906065-30906087 CTGGCCCCCGCCCTGCCTGGCGG - Intergenic
1106801642 13:33262360-33262382 GAGGTCCCCCCACTGGCTGGTGG - Intronic
1113878285 13:113608118-113608140 CAGGCAGCCGCTCTTCCTGGGGG + Intronic
1115043030 14:28955156-28955178 CAGCCCCTTGCACTTCCTGGGGG - Intergenic
1116846381 14:49868229-49868251 CCCGCCCGCCCACTTGCTGGTGG - Intergenic
1116883797 14:50198631-50198653 CAGGACCTAGCACATGCTGGTGG - Intronic
1122823238 14:104357500-104357522 CAGACCCAAGCACTGGCTGGAGG + Intergenic
1123006997 14:105328579-105328601 AAGTGCCACGCACTTGCTGGAGG + Intronic
1123034391 14:105466060-105466082 CAGGCCCCCGGAGCTGCTGGTGG - Intronic
1124101863 15:26703241-26703263 CAGGCACCGGCACCTGGTGGGGG + Intronic
1129086708 15:73101558-73101580 CAGGCCTCAGCACATGGTGGGGG - Intronic
1130966132 15:88699328-88699350 CATGGCCCAGCACTTGCTGTTGG - Intergenic
1132947781 16:2541571-2541593 CTGGCCCTCGCACCTGCTTGGGG - Intronic
1138081227 16:54093173-54093195 CTGGCCCCGGAACTTACTGGCGG + Intronic
1138553050 16:57757635-57757657 GAGTCCCCAGCACTGGCTGGCGG + Intergenic
1139650923 16:68361693-68361715 CTGGCCCGAGCTCTTGCTGGTGG + Exonic
1142160309 16:88554158-88554180 AAGGCCTCCGCGTTTGCTGGTGG + Intergenic
1143323484 17:6082981-6083003 CAGGCCATTGCACTTGCTGTAGG + Intronic
1144293104 17:13845537-13845559 CAGGGCCCCGCAACTGCTTGTGG - Intergenic
1145139698 17:20442190-20442212 AATGGCCCAGCACTTGCTGGAGG - Intergenic
1145224574 17:21117185-21117207 CAGGCCCCACCGCCTGCTGGAGG + Intergenic
1148027696 17:44599996-44600018 CAGGCCCTCGCACTTGCCAATGG + Intergenic
1150134878 17:62690071-62690093 CATGCCCCCGCCCTGGCAGGTGG - Intronic
1151495496 17:74455699-74455721 CAGGCCACTGCAGCTGCTGGTGG - Intergenic
1152460235 17:80438662-80438684 CAGGCCCCCACCCTGCCTGGAGG + Intergenic
1152647800 17:81477801-81477823 GCGGCCCCAGCGCTTGCTGGTGG + Intergenic
1155205435 18:23554104-23554126 CAGGGCTCTGCACTTGCTGCTGG + Intronic
1160537677 18:79603751-79603773 CAGGCCTGCGCTCTTGCTGGCGG + Intergenic
1161044900 19:2129529-2129551 CAGGCCCCAGAACTTCCTCGCGG - Intronic
1161714416 19:5867249-5867271 CAGGTGCCGGCAGTTGCTGGGGG + Exonic
1161729357 19:5949669-5949691 CAGTCCCCCACACTGGCAGGTGG - Intronic
1162052993 19:8046398-8046420 CTGGCCCCCGCACATCCTGCAGG + Intronic
1166357281 19:42234588-42234610 CAAGCCCCAGAACCTGCTGGTGG - Exonic
1167260613 19:48455751-48455773 CAGGCCCCCGCAGTGCCAGGGGG - Exonic
926139453 2:10359647-10359669 CAGGCCCACTCAGTGGCTGGCGG + Intronic
929604151 2:43224441-43224463 CAGCCCCCCGGACTCGCTGTCGG - Exonic
931638217 2:64359575-64359597 CAGGCACACGCACTTGCATGTGG - Intergenic
936350232 2:111706916-111706938 CAGGGCACAGCACTTGCAGGTGG - Intergenic
939175462 2:138742684-138742706 CAGGCATCTGCACTTGCTGTTGG + Intronic
945995266 2:216431076-216431098 CAGGCCCCCGCCCAGGCTGCAGG + Intronic
947603387 2:231468272-231468294 CAGGCCCCTGAGCCTGCTGGAGG + Intronic
948902703 2:240964422-240964444 GGGGCCCCCGCACCTCCTGGTGG - Intronic
1170793037 20:19523559-19523581 CAGGCCCCATGGCTTGCTGGTGG + Intronic
1174161315 20:48552732-48552754 CAGGCCTCCGGACCTGCAGGCGG + Intergenic
1174891350 20:54398485-54398507 CTGGCCCTTGCCCTTGCTGGTGG + Intergenic
1176145223 20:63562455-63562477 CCGGGCCCCTCACTTGCAGGAGG - Intronic
1181311739 22:21948645-21948667 CAGGCACTGGCAGTTGCTGGGGG - Intronic
1184055244 22:42043161-42043183 CATGCCCCCACACTTTGTGGAGG - Intronic
1184583544 22:45432857-45432879 CAAGCGCCCACACTTCCTGGGGG - Intergenic
1185142024 22:49107872-49107894 CAGGCCTCTGCTCATGCTGGAGG + Intergenic
1185195101 22:49464433-49464455 CAGGACCCCGCACCGGCTGGTGG + Intronic
1185199216 22:49491623-49491645 CAGGCCCCAGCACTTCCAAGGGG - Intronic
1185250878 22:49801035-49801057 CAGTCCCACGCACCTGCTGGCGG - Intronic
1185384979 22:50527433-50527455 CAGGCCACCCCACATGGTGGTGG + Intronic
952729209 3:36621201-36621223 CAGGCCCCGGCACTGGATGAGGG + Intergenic
954886759 3:53881859-53881881 CAGGCCCCAGCCCCTGGTGGGGG - Intronic
961424838 3:126836883-126836905 CAGTCCCCCGCACTTGCTCCTGG - Intronic
961633453 3:128318121-128318143 CCTGGCCCAGCACTTGCTGGTGG + Intronic
962383528 3:134915091-134915113 CAGGCCCTAGTATTTGCTGGAGG + Intronic
962951615 3:140224988-140225010 CTGGCTGGCGCACTTGCTGGTGG - Intronic
968279695 3:197466972-197466994 CAGGCCCCCGCACTTGCTGGTGG + Intergenic
968737324 4:2304160-2304182 CAGGGCCCAGCACCTGCCGGTGG + Intronic
969217250 4:5732215-5732237 CAGGGCTCCGCACGTGGTGGGGG + Intronic
970585748 4:17512292-17512314 CGAGGCCCAGCACTTGCTGGCGG - Intergenic
990465854 5:56070636-56070658 CAGGCCCCCGCTAGTGCTGGGGG - Intergenic
1001710017 5:173771133-173771155 CTGGCCCCTGCAGTTGCGGGAGG - Intergenic
1001837186 5:174842389-174842411 CAGGCCCCAGACCTTGCTAGGGG + Intergenic
1002451889 5:179323479-179323501 CAGGCCACAGCACTTGCCAGGGG + Intronic
1003139205 6:3456915-3456937 CCGGCCCGCGCCCTTGCCGGCGG + Intronic
1003291892 6:4786950-4786972 CTGGCTTCTGCACTTGCTGGTGG + Intronic
1004008428 6:11658065-11658087 CAGACCCCAGCACTTACTAGGGG - Intergenic
1006104277 6:31707245-31707267 CAGACCCCCTCACTGGCTGGGGG + Intronic
1007412974 6:41675396-41675418 CAGGCCCTGGCTCTTGGTGGGGG + Intergenic
1018059674 6:160080515-160080537 TAGGCCCACTCACTAGCTGGAGG + Intronic
1021451263 7:20785356-20785378 CAGGCCCCCGGAGTTTCCGGGGG - Exonic
1022090947 7:27108004-27108026 CAGGCCCCGGCCCGTGGTGGTGG + Exonic
1023882119 7:44326409-44326431 CAGGCCCCCCAAATTGCTGGTGG - Intronic
1029041559 7:97580963-97580985 CAGGCTGCTGCATTTGCTGGGGG - Intergenic
1029459045 7:100685036-100685058 CAGGCCCCCACACCTGCTGCAGG + Exonic
1029491464 7:100872753-100872775 CAGCCCCTTGCACGTGCTGGGGG - Intronic
1033257841 7:139817350-139817372 CAGGCCACAGGACTTGCTGGCGG - Intronic
1034455679 7:151168349-151168371 CAGCCCCGCGCTCTCGCTGGAGG - Intronic
1034562639 7:151891224-151891246 CAGGAGCACGCACTTGCTGTGGG - Intergenic
1034969844 7:155412133-155412155 CAGGCCCCAGCACTTGTTGGTGG - Intergenic
1035248154 7:157578481-157578503 CCGACACCCTCACTTGCTGGTGG + Intronic
1036601782 8:10267677-10267699 CAGTCCCCCACACCTGCTGGGGG + Intronic
1036765549 8:11547482-11547504 CGGGCCCCCCACCTTGCTGGCGG - Intronic
1037606360 8:20441001-20441023 CAGCCCCTCCCACGTGCTGGGGG + Intergenic
1038065069 8:23955379-23955401 GAAACCCCTGCACTTGCTGGTGG + Intergenic
1042465871 8:69129631-69129653 CAGGCCCCTGCAGTAGCAGGCGG + Intergenic
1045188953 8:99864807-99864829 CAGGCTCCTGTCCTTGCTGGAGG - Intronic
1049434230 8:142579141-142579163 CATGCTCCCGCCCTTGCTGCTGG + Intergenic
1049638906 8:143705526-143705548 CAGGCCCCGGGAGGTGCTGGGGG + Intronic
1049791472 8:144474548-144474570 CAGGGCACCGCAGTTCCTGGGGG - Exonic
1052932704 9:34068619-34068641 AAGGCCCCAGCACCTGTTGGAGG - Intergenic
1056020982 9:82438086-82438108 CAGGCTGCTGCACTTGCTGGAGG - Intergenic
1057070914 9:92099246-92099268 CAGGCTGCTGCACTTGCTGGAGG + Intronic
1059638022 9:116189733-116189755 CAGGACCCTGGACTTGCTGATGG + Intronic
1062066248 9:134527908-134527930 AAGCCTCCTGCACTTGCTGGTGG - Intergenic
1062364493 9:136202394-136202416 CAGGCCCCCCAGCTTCCTGGTGG - Intronic
1062529980 9:136995548-136995570 CAGGTCCCCGGACGTGCTGAAGG - Exonic
1062623083 9:137431332-137431354 CAGGCCCACGCACCTGCTCCTGG - Exonic
1187891041 X:23935214-23935236 GAGGCCCCTGCATTTTCTGGCGG + Exonic
1190116603 X:47629613-47629635 GAGGCCCTTGCACTTGCCGGAGG + Exonic
1200787824 Y:7274673-7274695 GAGTCCCCCGGACTGGCTGGGGG + Intergenic