ID: 968280530

View in Genome Browser
Species Human (GRCh38)
Location 3:197473670-197473692
Sequence TAGAATCCCAAATAAAGGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968280530_968280543 29 Left 968280530 3:197473670-197473692 CCTTGCCTTTATTTGGGATTCTA No data
Right 968280543 3:197473722-197473744 CCTCCCAGTTAAGGATGAGCAGG No data
968280530_968280532 -9 Left 968280530 3:197473670-197473692 CCTTGCCTTTATTTGGGATTCTA No data
Right 968280532 3:197473684-197473706 GGGATTCTATTTGCTCCCTGAGG No data
968280530_968280536 2 Left 968280530 3:197473670-197473692 CCTTGCCTTTATTTGGGATTCTA No data
Right 968280536 3:197473695-197473717 TGCTCCCTGAGGCCCTCTGGGGG No data
968280530_968280534 0 Left 968280530 3:197473670-197473692 CCTTGCCTTTATTTGGGATTCTA No data
Right 968280534 3:197473693-197473715 TTTGCTCCCTGAGGCCCTCTGGG No data
968280530_968280533 -1 Left 968280530 3:197473670-197473692 CCTTGCCTTTATTTGGGATTCTA No data
Right 968280533 3:197473692-197473714 ATTTGCTCCCTGAGGCCCTCTGG No data
968280530_968280541 20 Left 968280530 3:197473670-197473692 CCTTGCCTTTATTTGGGATTCTA No data
Right 968280541 3:197473713-197473735 GGGGGTCTGCCTCCCAGTTAAGG No data
968280530_968280535 1 Left 968280530 3:197473670-197473692 CCTTGCCTTTATTTGGGATTCTA No data
Right 968280535 3:197473694-197473716 TTGCTCCCTGAGGCCCTCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968280530 Original CRISPR TAGAATCCCAAATAAAGGCA AGG (reversed) Intergenic
No off target data available for this crispr