ID: 968286065

View in Genome Browser
Species Human (GRCh38)
Location 3:197509616-197509638
Sequence CCGGCCTGTGCAGGTTGTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 90}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968286065 Original CRISPR CCGGCCTGTGCAGGTTGTTC TGG (reversed) Intergenic
900927847 1:5717333-5717355 CCGGCCAGTCCGGGATGTTCTGG - Intergenic
901343092 1:8512958-8512980 CCAGCCTGGGGAGGTTGGTCTGG - Intronic
902819659 1:18936230-18936252 CTGGACTGTGGAGGTTGTTTGGG - Intronic
903639509 1:24848710-24848732 CCGGCCTGTGCCGGGCGTCCAGG - Intergenic
904774609 1:32899111-32899133 CCGGCATGTGCAGGTAGGGCTGG - Intronic
906728371 1:48060443-48060465 ACAGCTTGTTCAGGTTGTTCAGG + Intergenic
908585750 1:65565933-65565955 CTGGTCTGTACATGTTGTTCTGG + Intronic
911995019 1:104756351-104756373 CCTGTCTGTGCAGTTTCTTCAGG - Intergenic
913645879 1:120853239-120853261 CGGTCCTGTCCAGGTTGTTATGG - Intergenic
914080760 1:144409644-144409666 CGGTCCTGTCCAGGTTGTTATGG + Intergenic
914175674 1:145278178-145278200 CGGTCCTGTCCAGGTTGTTATGG + Intergenic
914530393 1:148519647-148519669 CGGTCCTGTCCAGGTTGTTATGG + Intergenic
917701859 1:177589814-177589836 CAGGCCTCTGCAGGTGGTTTTGG - Intergenic
919831401 1:201542657-201542679 CCTGCCTGTGGATGTGGTTCAGG + Intergenic
1063214754 10:3914040-3914062 TCAGCCTGTACAGGTTATTCAGG + Intergenic
1065727006 10:28677027-28677049 CCGGCCTGTGCAGGTGGCGGAGG - Intergenic
1066093981 10:32055783-32055805 CCGGCCTGTGCGGGGAGTTTAGG - Intronic
1071545938 10:86529405-86529427 CTGGACTGTGCAGCCTGTTCTGG - Intergenic
1073424770 10:103449767-103449789 CCAGCCCGTACAGGTAGTTCCGG + Exonic
1074126327 10:110531318-110531340 CCGGCCTGTGGAGGAATTTCAGG - Intergenic
1076873860 10:133206502-133206524 CCGGCCTGGGCAGTGTGGTCTGG - Intronic
1084258176 11:67956493-67956515 CAGCCCAGTGGAGGTTGTTCAGG + Intergenic
1084328596 11:68416380-68416402 CCGGGCTGTGCTGGTCGTCCGGG - Exonic
1084586893 11:70067622-70067644 CCGGCCTGTGCGTGTTTTGCTGG + Intergenic
1085574520 11:77590097-77590119 CCGGCCTGTGCAGCTGCTGCCGG - Exonic
1091241105 11:134053099-134053121 CCCGCCTGTGCGTGCTGTTCTGG + Intergenic
1096182246 12:49557410-49557432 CCAGGCTGTGCAGCTTGTCCTGG + Exonic
1105678798 13:22704877-22704899 GTGGCCTGTGCAGGTTGCTTTGG - Intergenic
1105682442 13:22743320-22743342 CCTGGCTCTGCAGGTTGTACAGG - Intergenic
1105896854 13:24723867-24723889 CCATCCTGGGCAGGTTGTCCAGG + Intergenic
1115135737 14:30106142-30106164 CATGCCTGTGCAGTTTCTTCAGG - Intronic
1118355681 14:65011669-65011691 CCGGCCTGTGCAGGTGGCCATGG + Intronic
1121614161 14:95301650-95301672 CAGGAATGTGCTGGTTGTTCAGG - Intronic
1122718976 14:103711780-103711802 CCGGCCTCAGCAGGCTGCTCAGG + Exonic
1124159403 15:27255032-27255054 CAGGCCTTTGCAGTTTGTCCAGG + Intronic
1125206530 15:37159812-37159834 GATGCCTGTGCAGGATGTTCAGG - Intergenic
1125591610 15:40857714-40857736 CCGTCCTGTTCAGCTGGTTCAGG + Exonic
1131562188 15:93454504-93454526 CAGGCCAGTGCAGGGTTTTCAGG + Intergenic
1132727324 16:1344615-1344637 CCTGCCTGGGCTGGTTGTGCTGG + Exonic
1132751598 16:1460187-1460209 CAGGCCTGTGCTGGTAGGTCAGG + Intronic
1139717197 16:68823027-68823049 CTGGCCTGTGAAGGTTGGTCAGG - Intronic
1141158738 16:81614614-81614636 CAGGACTGTGCAGGTAGTTTTGG - Intronic
1146574017 17:33976376-33976398 CAGGCCTGGGCAGGTTATTGTGG - Intronic
1150207802 17:63421859-63421881 GCTGCCTGTACAGGTTGTCCTGG - Exonic
1151825282 17:76520608-76520630 GCGGCCTGTGCAGGATGGACTGG + Intergenic
1153661578 18:7330870-7330892 CCGGCTTGTGCCTGTTGCTCTGG - Intergenic
1160801494 19:972104-972126 CCGGCCTGGGCAGGGGGTCCAGG + Exonic
1161067791 19:2247146-2247168 CCGGCCTGTGCAGACCCTTCTGG - Intronic
1161321892 19:3645253-3645275 CAGGCCTGTGCAGGATGCTGGGG + Intronic
1161364759 19:3872013-3872035 CCAGCCTGTGGAGGTTGGTCAGG - Intergenic
1161380831 19:3964196-3964218 CCGGCCTGGGGAGGGTGGTCTGG - Intronic
1161521057 19:4723692-4723714 CCGGACTGGGCAGGTCGTCCCGG + Exonic
1162295023 19:9807502-9807524 CTGGACTCTGCAGGTGGTTCTGG - Intergenic
1162444870 19:10716646-10716668 CCGGCCTGTGAGGGTCGTTTGGG + Intergenic
1162793378 19:13074387-13074409 CCAGCCTGTGCAGGCTGAACTGG - Intronic
1167349672 19:48966651-48966673 CCAGCCTGTGGAGGTTGGTCAGG - Exonic
925390415 2:3490373-3490395 CCGGCCTCTGCAGGTTGCCTGGG + Intergenic
926268023 2:11344207-11344229 CCGGCCGGAGCTGGTGGTTCGGG - Exonic
934038760 2:88110434-88110456 CCTGCATGGGCTGGTTGTTCAGG - Exonic
937338651 2:121077117-121077139 CTGGCAGGTGCAGGTTGTGCAGG - Intergenic
939914066 2:148019291-148019313 CCGGCCGGTGTAGGTTCTTTAGG - Intronic
942538939 2:176995427-176995449 CCAGCCTGTGCAACTAGTTCAGG + Intergenic
946416616 2:219543249-219543271 CCGGGCTGTGCAGGGTGGTAGGG + Exonic
948652476 2:239457090-239457112 CCAGGCTGTGCAGGGAGTTCTGG - Intergenic
1169245915 20:4024360-4024382 CCAGCCTGTGGAGGTTCGTCAGG - Intergenic
1172011016 20:31845605-31845627 CCAGCCTGGGCAGGCTATTCCGG - Exonic
1172331381 20:34078275-34078297 CAGGCCAGTGAAGGGTGTTCTGG - Intronic
1172876351 20:38166610-38166632 CCGGAATGTACAGCTTGTTCTGG - Intergenic
1179972170 21:44842289-44842311 CCGGCGCCTGCAGGTTGCTCTGG - Intergenic
1182664671 22:31948919-31948941 CCGGACTGTGGAAGTTCTTCTGG - Intronic
1182749652 22:32631327-32631349 CTGGCCTCTGCAGGTTTTTCTGG - Intronic
1183408381 22:37641199-37641221 CAGGCCTGTGCAGGCTGTCTCGG + Intronic
1183771176 22:39927266-39927288 CCGGCATGTGCAAGTTGGTCTGG + Intronic
1183781358 22:40001068-40001090 CCGGCCTGTCCAGGTATTCCTGG + Intronic
1183828304 22:40405211-40405233 CCCGCCTGCGCAGGGTGCTCCGG + Exonic
954107636 3:48417975-48417997 CCAGCATGTGCAGGATGTGCTGG - Exonic
968286065 3:197509616-197509638 CCGGCCTGTGCAGGTTGTTCTGG - Intergenic
968800825 4:2742375-2742397 CCGCCCTCTGCAGGGGGTTCTGG + Exonic
989295155 5:39817068-39817090 CCGGCCGGTACAGCTTGTTTAGG - Intergenic
993109088 5:83633157-83633179 CCTGTCTGTGCAGATTCTTCTGG - Intergenic
1006712940 6:36091145-36091167 CTGGCCTGTGGAGGTTTTTTAGG + Intronic
1007397712 6:41587077-41587099 CCTGCCTCTGCAGGTTGAGCAGG - Exonic
1008380910 6:50839050-50839072 CCTGCCTCTGGAGGGTGTTCAGG - Intronic
1017823711 6:158066553-158066575 CCGTCCTGAGCACGTTGCTCCGG - Exonic
1024097697 7:45997610-45997632 GCAGCCTGTGGAGGTTGGTCAGG + Intergenic
1024258473 7:47557032-47557054 CTGACCTGTGCAGGGTGTGCAGG + Intronic
1029518438 7:101043457-101043479 GCAGCCTCTGCTGGTTGTTCTGG - Exonic
1035075800 7:156176562-156176584 CCAGCCTGTGCACTTTGTTATGG + Intergenic
1049594980 8:143479141-143479163 CGGGCCTGTGCAGGTTGGCGGGG + Intronic
1054810307 9:69429040-69429062 CCGTTATGTGCAGGTTGTACAGG + Exonic
1186246999 X:7625237-7625259 CCGCCATGTGCATGATGTTCAGG - Intergenic
1188480352 X:30630741-30630763 CCAGCCTGTGGAGGGTGGTCAGG - Intergenic
1189035770 X:37492458-37492480 CCATCTTGTGCAGGTTGCTCAGG - Intronic
1190502469 X:51093255-51093277 CAGCCCTGTGAAGGTTGTTGTGG - Intergenic
1202141706 Y:21731193-21731215 CAGTCATGTTCAGGTTGTTCAGG - Intergenic
1202145159 Y:21772609-21772631 CAGTCATGTTCAGGTTGTTCAGG + Intergenic