ID: 968286196

View in Genome Browser
Species Human (GRCh38)
Location 3:197510249-197510271
Sequence CGCGCTGCCGCCCGAGCCTG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 153}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968286196_968286207 16 Left 968286196 3:197510249-197510271 CCTCAGGCTCGGGCGGCAGCGCG 0: 1
1: 0
2: 2
3: 18
4: 153
Right 968286207 3:197510288-197510310 GAGGCCGGCGCCGGCTGCGGAGG 0: 1
1: 0
2: 3
3: 76
4: 724
968286196_968286208 19 Left 968286196 3:197510249-197510271 CCTCAGGCTCGGGCGGCAGCGCG 0: 1
1: 0
2: 2
3: 18
4: 153
Right 968286208 3:197510291-197510313 GCCGGCGCCGGCTGCGGAGGAGG 0: 1
1: 0
2: 3
3: 122
4: 2021
968286196_968286202 -6 Left 968286196 3:197510249-197510271 CCTCAGGCTCGGGCGGCAGCGCG 0: 1
1: 0
2: 2
3: 18
4: 153
Right 968286202 3:197510266-197510288 AGCGCGGGAGTCTGGGGCGCTGG 0: 1
1: 0
2: 1
3: 16
4: 209
968286196_968286204 1 Left 968286196 3:197510249-197510271 CCTCAGGCTCGGGCGGCAGCGCG 0: 1
1: 0
2: 2
3: 18
4: 153
Right 968286204 3:197510273-197510295 GAGTCTGGGGCGCTGGAGGCCGG 0: 1
1: 2
2: 3
3: 54
4: 474
968286196_968286205 7 Left 968286196 3:197510249-197510271 CCTCAGGCTCGGGCGGCAGCGCG 0: 1
1: 0
2: 2
3: 18
4: 153
Right 968286205 3:197510279-197510301 GGGGCGCTGGAGGCCGGCGCCGG 0: 1
1: 0
2: 3
3: 114
4: 561
968286196_968286203 -3 Left 968286196 3:197510249-197510271 CCTCAGGCTCGGGCGGCAGCGCG 0: 1
1: 0
2: 2
3: 18
4: 153
Right 968286203 3:197510269-197510291 GCGGGAGTCTGGGGCGCTGGAGG 0: 1
1: 0
2: 0
3: 31
4: 399
968286196_968286206 13 Left 968286196 3:197510249-197510271 CCTCAGGCTCGGGCGGCAGCGCG 0: 1
1: 0
2: 2
3: 18
4: 153
Right 968286206 3:197510285-197510307 CTGGAGGCCGGCGCCGGCTGCGG 0: 1
1: 0
2: 1
3: 27
4: 268

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968286196 Original CRISPR CGCGCTGCCGCCCGAGCCTG AGG (reversed) Exonic