ID: 968286196

View in Genome Browser
Species Human (GRCh38)
Location 3:197510249-197510271
Sequence CGCGCTGCCGCCCGAGCCTG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 153}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968286196_968286203 -3 Left 968286196 3:197510249-197510271 CCTCAGGCTCGGGCGGCAGCGCG 0: 1
1: 0
2: 2
3: 18
4: 153
Right 968286203 3:197510269-197510291 GCGGGAGTCTGGGGCGCTGGAGG 0: 1
1: 0
2: 0
3: 31
4: 399
968286196_968286208 19 Left 968286196 3:197510249-197510271 CCTCAGGCTCGGGCGGCAGCGCG 0: 1
1: 0
2: 2
3: 18
4: 153
Right 968286208 3:197510291-197510313 GCCGGCGCCGGCTGCGGAGGAGG 0: 1
1: 0
2: 3
3: 122
4: 2021
968286196_968286204 1 Left 968286196 3:197510249-197510271 CCTCAGGCTCGGGCGGCAGCGCG 0: 1
1: 0
2: 2
3: 18
4: 153
Right 968286204 3:197510273-197510295 GAGTCTGGGGCGCTGGAGGCCGG 0: 1
1: 2
2: 3
3: 54
4: 474
968286196_968286202 -6 Left 968286196 3:197510249-197510271 CCTCAGGCTCGGGCGGCAGCGCG 0: 1
1: 0
2: 2
3: 18
4: 153
Right 968286202 3:197510266-197510288 AGCGCGGGAGTCTGGGGCGCTGG 0: 1
1: 0
2: 1
3: 16
4: 209
968286196_968286205 7 Left 968286196 3:197510249-197510271 CCTCAGGCTCGGGCGGCAGCGCG 0: 1
1: 0
2: 2
3: 18
4: 153
Right 968286205 3:197510279-197510301 GGGGCGCTGGAGGCCGGCGCCGG 0: 1
1: 0
2: 3
3: 114
4: 561
968286196_968286207 16 Left 968286196 3:197510249-197510271 CCTCAGGCTCGGGCGGCAGCGCG 0: 1
1: 0
2: 2
3: 18
4: 153
Right 968286207 3:197510288-197510310 GAGGCCGGCGCCGGCTGCGGAGG 0: 1
1: 0
2: 3
3: 76
4: 724
968286196_968286206 13 Left 968286196 3:197510249-197510271 CCTCAGGCTCGGGCGGCAGCGCG 0: 1
1: 0
2: 2
3: 18
4: 153
Right 968286206 3:197510285-197510307 CTGGAGGCCGGCGCCGGCTGCGG 0: 1
1: 0
2: 1
3: 27
4: 268

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968286196 Original CRISPR CGCGCTGCCGCCCGAGCCTG AGG (reversed) Exonic
901022352 1:6261622-6261644 CACGCTGCTCCCCGGGCCTGGGG + Intergenic
901235072 1:7663347-7663369 CACGCTGCCGCCAGCTCCTGCGG - Exonic
901642062 1:10697623-10697645 CTCTCTCCCTCCCGAGCCTGGGG + Intronic
901739313 1:11331820-11331842 CCCTCTGCCTCCCCAGCCTGAGG - Intergenic
902607654 1:17577685-17577707 CGCACTGCCTCCCTAGCCTTTGG - Intronic
904617181 1:31756187-31756209 CGCGCTGCCGGCAGGGCCTGCGG - Exonic
904795814 1:33055592-33055614 CCCTCTGCAGCCCCAGCCTGGGG + Intronic
906641704 1:47444859-47444881 AGAGCTGCCGCTCGAGGCTGAGG + Intergenic
908796124 1:67833042-67833064 CGGGCGGCCGCCCGAGGTTGCGG - Intronic
910408552 1:86915210-86915232 GGCGCTGCCGCCGGAGCAAGTGG + Intronic
910676626 1:89821833-89821855 CGCCCCGCCCCCCGCGCCTGTGG + Intronic
917565255 1:176206793-176206815 CCCGAGGCCGCCCGAGCCGGCGG + Exonic
920575106 1:207053460-207053482 CGCGCTGCCTGCCATGCCTGGGG - Intronic
923519245 1:234723198-234723220 CAGGCGGGCGCCCGAGCCTGCGG - Intergenic
1067111850 10:43407162-43407184 CTCCCTGCCGCCTGAGGCTGTGG + Intronic
1073728776 10:106267272-106267294 CTCTCTACCGACCGAGCCTGGGG - Intergenic
1074865817 10:117543776-117543798 CGCGCTGGCCCGCGAGCCGGAGG - Intronic
1077021113 11:417528-417550 GCCGCTGCCGCACGGGCCTGGGG + Intergenic
1077465690 11:2732785-2732807 CGCCTTGCAGCCGGAGCCTGGGG + Intronic
1077497377 11:2892674-2892696 CGGGCTGCCGGCCGGGCCTGCGG - Intronic
1078830753 11:14974258-14974280 CGCCCTGCCGGCGGACCCTGCGG - Intronic
1079128535 11:17734956-17734978 GGCGCTGCCGGCCGAGACGGGGG - Exonic
1080012320 11:27471996-27472018 CCCGCCGCCGCCCGGGCCTGGGG - Intronic
1083442723 11:62687802-62687824 CGAGCCGCCGCCCGAGCCGCAGG - Exonic
1083572610 11:63768506-63768528 CGCGCTGCCGCTCGATCCGGCGG + Exonic
1084178708 11:67436279-67436301 CGCGCTGCCACCCGAGCCCAAGG + Exonic
1084265859 11:68004748-68004770 CGGGCTGCAGCGGGAGCCTGTGG + Intronic
1084758379 11:71252733-71252755 CCCGCTCCCGCCCGCGGCTGCGG + Intergenic
1088812507 11:113401022-113401044 GGCTCTCCCGCCCCAGCCTGAGG - Intergenic
1091743560 12:2976777-2976799 CCCATTGCCGCCCGGGCCTGGGG + Intronic
1093268474 12:17028091-17028113 CTCTCTGCTGGCCGAGCCTGGGG - Intergenic
1095954166 12:47797032-47797054 CGGGCCGCCGCCGGAGGCTGGGG + Exonic
1101131662 12:101697317-101697339 CACGCTGCCCGCAGAGCCTGGGG - Intronic
1102997410 12:117361054-117361076 CCCGCTCCCGCCCGAGCCCCTGG - Intronic
1103562011 12:121797737-121797759 CCCTCTGCCGCCCGAGGGTGTGG - Intronic
1104961488 12:132490346-132490368 CGCCCAGCCGCCCGCGCCGGGGG + Exonic
1105240976 13:18609540-18609562 CGCGCCCGCGCCCGCGCCTGTGG - Intergenic
1109789718 13:67230624-67230646 GCCGCTTCCGCCCGGGCCTGGGG - Intergenic
1113809558 13:113130030-113130052 CGCGCTGGCGCTCTAGGCTGTGG - Intronic
1113985849 13:114314808-114314830 CGCACTCCCGCCCCGGCCTGTGG - Intronic
1119732817 14:76961865-76961887 CCCGCTGCGGCCCCAGCCCGCGG + Intergenic
1122778044 14:104131465-104131487 CGCCCAGCTGCCCCAGCCTGAGG - Intergenic
1123042312 14:105495451-105495473 AGCTCTGCAGCCCAAGCCTGGGG + Intronic
1128280028 15:66387007-66387029 GGCTGTGCCGCCCGAGCCGGAGG + Exonic
1131493441 15:92882636-92882658 CGCGTTGGCCCCCGGGCCTGCGG + Intergenic
1132616181 16:842146-842168 AGCGCTGCCGCAGGAGGCTGAGG + Intergenic
1132794526 16:1712857-1712879 CACTCTGCCGCCCCTGCCTGGGG + Intronic
1133029682 16:3004459-3004481 CCCGCTGCGGCCCGAGCCGCTGG + Intergenic
1137426324 16:48384692-48384714 CGCGGTGCGGCCCGGGCCTCCGG + Intronic
1138923078 16:61556269-61556291 CGCGCTCCCTGCTGAGCCTGAGG - Intergenic
1141594886 16:85091156-85091178 CACTCTGCCGCCCGACCTTGAGG + Exonic
1142592812 17:1013811-1013833 TGGGCTCCAGCCCGAGCCTGGGG - Intronic
1143747129 17:9003119-9003141 CCCGCTGCCGCCGGCGCCTCGGG + Intergenic
1144775633 17:17783288-17783310 CGCGCTGCCGGCAGAGCCCGAGG + Intronic
1144781565 17:17810797-17810819 CGCGCGTCCGCCGGAGCCGGAGG - Exonic
1144892064 17:18499936-18499958 CGCGTTGCCCTCTGAGCCTGAGG - Intergenic
1145140161 17:20444381-20444403 CGCGTTGCCCTCTGAGCCTGAGG + Intergenic
1145810156 17:27759621-27759643 CGCGTTACCCCCTGAGCCTGGGG - Intronic
1147150446 17:38510882-38510904 CTCGCAGCCGCCCGCGCCCGGGG + Exonic
1148178350 17:45586006-45586028 CGGGCTGCCCACCCAGCCTGGGG - Intergenic
1148270811 17:46260461-46260483 CGGGCTGCCCACCCAGCCTGGGG + Intergenic
1148608470 17:48947672-48947694 CGCTCTGTCGCCCAGGCCTGAGG - Intergenic
1149994617 17:61400094-61400116 CGCGCCGCCGCCCGGGCCGGGGG + Exonic
1151825712 17:76523146-76523168 CGCGCTGCAGCCTGAGACCGAGG - Intergenic
1152049121 17:77958881-77958903 CGCGGGCCCGCCCGAGCCGGAGG + Intergenic
1152339498 17:79716370-79716392 CACGCTGACGCCAGAGCCTTCGG + Intergenic
1152529245 17:80907404-80907426 GGCGCTGCCTCCCCTGCCTGCGG - Intronic
1152741989 17:82022493-82022515 CGCCCTGCGCCCTGAGCCTGGGG - Intronic
1158427358 18:57352301-57352323 CAGGCTGCAGCCCGAGCCTACGG - Exonic
1159950305 18:74478170-74478192 GGGGCTGCCTCCCTAGCCTGGGG + Intergenic
1160766811 19:812515-812537 CGCGCGGCCGCCCGCGCCCTCGG + Exonic
1161219172 19:3110143-3110165 CCCGCTCTCGCCCGTGCCTGGGG - Exonic
1161487543 19:4543969-4543991 CGAGCAGCCCCCCGCGCCTGGGG - Exonic
1161688952 19:5719830-5719852 CGCGCTGCCCCCCGCGCCGCCGG + Exonic
1161950955 19:7467657-7467679 CGCGCTGCCGCCCGACACACTGG + Exonic
1162084513 19:8240493-8240515 CGTGCTCCCGCCTGAGCCTCTGG + Intronic
1165300829 19:34967685-34967707 CTCTCTGCCGGCTGAGCCTGGGG - Intergenic
1166838406 19:45681669-45681691 CGCGCTGCCGCCAGAGGGCGGGG - Intronic
1166872074 19:45877006-45877028 CGGCCTGAGGCCCGAGCCTGGGG - Intergenic
925421909 2:3719413-3719435 CCCGCTGCCTCCCAAGCCTCTGG + Intronic
927142062 2:20137343-20137365 CTCGCTGCCTCCGGGGCCTGAGG - Intergenic
928181290 2:29070802-29070824 ATCGCTGCCGCCAGAGGCTGGGG - Exonic
933354362 2:81195367-81195389 CGTGCTGCCGCCCCAGCCGAAGG - Intergenic
935396928 2:102619426-102619448 CGCGCACCTGCCCGAGCCCGCGG - Intergenic
935971562 2:108534589-108534611 CGCGGTGCGGCCCGTACCTGTGG - Intronic
937134870 2:119544161-119544183 GGCGGAGCCGCCCGAGCCAGTGG - Intergenic
941909655 2:170751733-170751755 AGCGCTGCCGCCGGGGCCTGGGG + Intergenic
942454789 2:176130272-176130294 CGCACTGCCGCGGGGGCCTGTGG - Exonic
947745060 2:232503184-232503206 CGCGCTCCCGCCCCCGCCCGCGG + Intergenic
948402017 2:237691778-237691800 GGAGCTGCGGCCGGAGCCTGAGG + Intronic
948824829 2:240569039-240569061 CACGCTGCCGCCCGAGCTGCAGG + Exonic
1168854380 20:998516-998538 CGCAGTGACGCCGGAGCCTGAGG + Intronic
1170756905 20:19212826-19212848 CGCCCGGCCGCCCGAGGATGCGG + Exonic
1172335480 20:34112160-34112182 AGCGCTGCCGCCGGGGCCTGGGG - Exonic
1172446753 20:34997245-34997267 AGCTCCTCCGCCCGAGCCTGGGG - Exonic
1172474456 20:35226669-35226691 CGCGCTGGCGGCCGAGGCGGCGG + Exonic
1174287251 20:49482417-49482439 CTCGCTGCCGCCCGAGCCCATGG - Exonic
1174379382 20:50146874-50146896 CCAGCAGCCGCCCCAGCCTGGGG + Intronic
1175429313 20:58891108-58891130 CGGGCTGCTGCCCGAGCCCGGGG + Intronic
1175541460 20:59750641-59750663 CACGCTGCTGCGGGAGCCTGGGG + Intronic
1175859882 20:62144196-62144218 CGCGCTGTCCCCCGAGTCCGCGG + Intronic
1176214478 20:63941719-63941741 CGCCCCGCTGCCCAAGCCTGGGG + Intronic
1176220831 20:63968811-63968833 CGCCCTGCTGCCCAAGGCTGGGG + Intronic
1176555544 21:8252752-8252774 CGCGGTGCCGCCGGGGCGTGAGG + Intergenic
1178950327 21:36980611-36980633 CGCGCGGCCGCCCGGGGCTCTGG - Intronic
1179890775 21:44334107-44334129 CACGCTGCTGCCTGTGCCTGAGG - Intronic
1180109857 21:45642840-45642862 GGCGCTGCGGCCCCAGCCTCCGG + Intergenic
1181002030 22:19992341-19992363 GGGGCCGCCGCCCGAGACTGAGG + Intronic
1183832416 22:40425377-40425399 TGAGCTGCCGCCCAAGCCTGGGG + Intronic
1184500029 22:44865849-44865871 CTCGCTGCCGCCCCATCCTACGG - Intergenic
1185078942 22:48698753-48698775 CGGGCTGCACCCCGAGGCTGCGG - Intronic
1185321292 22:50201252-50201274 CGCGCCGCGGCCCGTGCCCGGGG + Exonic
1185408551 22:50671380-50671402 CCCGCTGCCACCCCAGGCTGAGG - Intergenic
950729824 3:14947758-14947780 CCCGCTGCCCCGCGAGCCCGCGG + Intronic
950940338 3:16884962-16884984 CGCGCGGCGGCCCGAGGCGGCGG + Intronic
951217744 3:20040546-20040568 GGCGCTGCCCCCGCAGCCTGCGG + Exonic
953947586 3:47163392-47163414 CGAGCTTCCACCCGAGCCCGGGG + Intronic
956678318 3:71754828-71754850 CGCGCCGCGGCCCGGCCCTGCGG - Exonic
961868892 3:129974507-129974529 CGCGCCGGCGCCCCATCCTGCGG + Exonic
967055481 3:185825548-185825570 CGCGCTCCCACCCGCGCCCGGGG - Intergenic
968187008 3:196639848-196639870 CGCGCAGCCGCCTGCGCCTGCGG + Exonic
968286196 3:197510249-197510271 CGCGCTGCCGCCCGAGCCTGAGG - Exonic
971195751 4:24471008-24471030 CGCGCTCCCTCCCGGGCCCGGGG - Intergenic
972245743 4:37244358-37244380 CGCACAGACGCCCGAGCGTGTGG + Exonic
972396520 4:38663732-38663754 CGCGCCGCCGCCCGAGCCCGGGG - Intergenic
976733120 4:88284078-88284100 CGCGCTGGCCCTCCAGCCTGCGG + Intronic
984758097 4:183342614-183342636 CGCGCTGCTGCTCTACCCTGAGG + Intergenic
984778379 4:183504192-183504214 CGCGGTGCCGGGCGAGCCCGAGG + Intergenic
984928293 4:184825763-184825785 GGCGCGGCCCCACGAGCCTGGGG + Intronic
984966382 4:185143593-185143615 CGGGCGGGCGCCCGGGCCTGTGG - Intronic
985649370 5:1100203-1100225 CCCGGTGCCGCCCGAGGGTGAGG - Intronic
992487594 5:77210885-77210907 CGCGCGCCCGCCCGCGCCCGCGG - Exonic
997304085 5:132825771-132825793 CGCGCTGGCGGCCGAGGCGGAGG - Exonic
998266780 5:140672890-140672912 CGGGCTGCCCACCCAGCCTGTGG + Exonic
1001303236 5:170553055-170553077 CAAGCTGCGGCCCGTGCCTGGGG + Intronic
1001342721 5:170862233-170862255 CGGGCTCCGGCCCGGGCCTGGGG - Intronic
1002541217 5:179907673-179907695 CGCGCGGGCGGCCGGGCCTGTGG - Intronic
1011983965 6:93419147-93419169 GGCGCTGCCGGCCGCGCCTCCGG - Intronic
1012472617 6:99588950-99588972 CCAGCTGCGGCCCAAGCCTGTGG + Intergenic
1013492364 6:110660762-110660784 CTCTCTGCCGGCTGAGCCTGAGG + Intronic
1015561497 6:134520952-134520974 CGTGCTCCCTCCCAAGCCTGTGG + Intergenic
1019545067 7:1570157-1570179 CGCGCTGCCGGCAGGGCTTGGGG + Intronic
1019645469 7:2126485-2126507 CCCGCTGCCCCCCAGGCCTGAGG - Intronic
1021716887 7:23469396-23469418 CGCGCTTCCTCCCCACCCTGTGG - Intronic
1023758820 7:43444884-43444906 CGCGCTGCCGCCCTGGGCGGAGG - Exonic
1024026767 7:45416227-45416249 CTCCCTGCTGCCCCAGCCTGTGG + Intergenic
1024247314 7:47480066-47480088 GGCGCCGCTGGCCGAGCCTGGGG + Intronic
1030093383 7:105876858-105876880 AGCGGCGCCGCCCAAGCCTGGGG + Intronic
1030614784 7:111728366-111728388 CGCGCTGCCCCCCAAGCCTCTGG - Exonic
1031696154 7:124857516-124857538 CCCTCTGCCGGCTGAGCCTGGGG - Intronic
1031886610 7:127251715-127251737 CGCGGGGCCGCCCGAAACTGGGG + Intronic
1034859007 7:154580518-154580540 AGCGCTGCCGTTAGAGCCTGAGG + Intronic
1035171185 7:157018220-157018242 TGCGCTGCCACCCAAGCTTGGGG + Intergenic
1035435553 7:158856707-158856729 ACCGCGGCCGCCCGGGCCTGCGG + Exonic
1036454251 8:8893564-8893586 CGCGCTCCCGCCCGAGCCCGGGG - Exonic
1036649209 8:10631718-10631740 GCCAGTGCCGCCCGAGCCTGTGG + Intronic
1036775960 8:11613331-11613353 GCCGCTGCCGCCCGGGCCTGAGG - Intergenic
1037273806 8:17156731-17156753 GGCGCTGCTGCCCGGGCCCGAGG - Exonic
1037716836 8:21408080-21408102 GGTGCTGCCGCCCAAGCCTCTGG - Intergenic
1037769311 8:21789442-21789464 CGCCCTGCCCCCCGAGCCCCCGG - Intronic
1042679183 8:71361850-71361872 CGCTCGGCAGCCCGAGCCTGCGG - Exonic
1049338906 8:142101427-142101449 GGCGCTGCCTTCCGAGCCAGGGG - Intergenic
1049616597 8:143578278-143578300 CGCGCCGCCGCGCGCGCCTCGGG + Exonic
1049658960 8:143811255-143811277 GGCGCTGCCGCCCGAGATCGGGG - Exonic
1049738608 8:144223209-144223231 CGCGCTGCCCCCCGAGCAGGAGG + Exonic
1061863431 9:133479247-133479269 CGCGGTGCCGGCCGCGCCCGGGG - Intergenic
1061975749 9:134067467-134067489 CGCGCGGCGGCCCCGGCCTGCGG - Intronic
1062160180 9:135075615-135075637 GGCGCCGCCGCCGGAGCCAGCGG + Intronic
1062413690 9:136437509-136437531 CCCGCTGCCTCCCGCTCCTGGGG - Intronic
1062499531 9:136846309-136846331 GGCGCTGCCGGCCGAGGCGGGGG - Exonic
1195278929 X:103310776-103310798 CGCGCTGCTGCCCGGGGATGGGG + Exonic
1200064350 X:153497422-153497444 CACCCTGCCGACCGGGCCTGGGG + Intronic
1200117303 X:153774992-153775014 CCCGCTGCAGCCCAAGCCTGAGG + Exonic
1200126146 X:153815999-153816021 CACCCTGCCGACCGGGCCTGGGG - Intronic