ID: 968288222

View in Genome Browser
Species Human (GRCh38)
Location 3:197520442-197520464
Sequence GCCTCCCCTCTGTGTGGGCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 359
Summary {0: 1, 1: 0, 2: 4, 3: 29, 4: 325}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968288217_968288222 -5 Left 968288217 3:197520424-197520446 CCCGGGCAGGGGGTGAGTGCCTC 0: 1
1: 0
2: 3
3: 34
4: 333
Right 968288222 3:197520442-197520464 GCCTCCCCTCTGTGTGGGCCGGG 0: 1
1: 0
2: 4
3: 29
4: 325
968288215_968288222 2 Left 968288215 3:197520417-197520439 CCAGATCCCCGGGCAGGGGGTGA 0: 1
1: 0
2: 4
3: 11
4: 156
Right 968288222 3:197520442-197520464 GCCTCCCCTCTGTGTGGGCCGGG 0: 1
1: 0
2: 4
3: 29
4: 325
968288218_968288222 -6 Left 968288218 3:197520425-197520447 CCGGGCAGGGGGTGAGTGCCTCC 0: 1
1: 0
2: 0
3: 16
4: 239
Right 968288222 3:197520442-197520464 GCCTCCCCTCTGTGTGGGCCGGG 0: 1
1: 0
2: 4
3: 29
4: 325
968288216_968288222 -4 Left 968288216 3:197520423-197520445 CCCCGGGCAGGGGGTGAGTGCCT 0: 1
1: 0
2: 2
3: 16
4: 194
Right 968288222 3:197520442-197520464 GCCTCCCCTCTGTGTGGGCCGGG 0: 1
1: 0
2: 4
3: 29
4: 325
968288214_968288222 3 Left 968288214 3:197520416-197520438 CCCAGATCCCCGGGCAGGGGGTG 0: 1
1: 0
2: 1
3: 28
4: 212
Right 968288222 3:197520442-197520464 GCCTCCCCTCTGTGTGGGCCGGG 0: 1
1: 0
2: 4
3: 29
4: 325

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968288222 Original CRISPR GCCTCCCCTCTGTGTGGGCC GGG Intronic
900407400 1:2498655-2498677 CCCTCCCGCCTGTGTGGGGCTGG - Intronic
900496504 1:2978384-2978406 CCCTCCCCTCTGGTGGGGCCTGG - Intergenic
900559474 1:3296586-3296608 GCCTCCCCTGGCTTTGGGCCAGG - Intronic
901022589 1:6262654-6262676 GCCATGCCTCTGTCTGGGCCTGG + Intergenic
901633295 1:10658303-10658325 CCCTCCGCTCTGTGTAGTCCAGG - Intronic
901686618 1:10946956-10946978 GCATCCCCTCTGCCTGGGCCGGG + Intronic
901811904 1:11772148-11772170 CCCTGTCCTCTGTGTGGCCCTGG - Exonic
902235168 1:15052881-15052903 GTCTCATCTCTGTCTGGGCCTGG - Intronic
902404317 1:16174572-16174594 TCCCTCCCTCTGTGTTGGCCTGG + Intergenic
902878105 1:19353072-19353094 CCCTTCCCTGTGTGTGGCCCCGG - Intronic
903667627 1:25017591-25017613 ACCTCCCCACTGTGTGGCCCTGG + Intergenic
903742015 1:25563829-25563851 GCCTGACCTCTGGGTGAGCCTGG + Intronic
903778733 1:25808842-25808864 GCCACCCCTCTGTCTGCGCCTGG + Intronic
904472751 1:30746123-30746145 GCCTCACTGCTGTGTGGCCCTGG + Intronic
904510151 1:30998443-30998465 GCGTCTCCTCTGTGTTGCCCAGG - Intronic
904717532 1:32480250-32480272 GCCTTTCCTCTGTGTGTGCTGGG + Intronic
905058658 1:35120953-35120975 TCCGCCCCGCTGTCTGGGCCTGG - Intergenic
905249088 1:36636580-36636602 ACCTCCCCTCTGTGTGTGTCGGG + Intergenic
905792760 1:40799046-40799068 GCCCTCCCTCTGTCTTGGCCAGG + Intronic
906747114 1:48229842-48229864 GCTAGCCCTCTGTGTGGGCTTGG - Intronic
906757288 1:48330501-48330523 GCCTTGCTTCTGTGTGAGCCTGG + Intronic
906894635 1:49757962-49757984 GCATCCCCTCCCTGTAGGCCTGG + Intronic
907321877 1:53607905-53607927 GCCTTTCCTCAGTGTGGGCACGG + Intronic
907722293 1:56983437-56983459 GCCTCTTCTCTGTGTGGCACTGG - Intergenic
907905761 1:58782926-58782948 GGCTCCCCACTGGGTCGGCCAGG + Exonic
908388210 1:63662547-63662569 GCCTGGCCACTGTGTAGGCCTGG - Intergenic
909647574 1:77934646-77934668 GCCATCCCTCTGGGTGGCCCAGG + Intronic
912050272 1:105521189-105521211 GACTACCATCTCTGTGGGCCTGG - Intergenic
914444715 1:147740185-147740207 GTCTCTCCTTTCTGTGGGCCTGG - Intergenic
915092050 1:153433376-153433398 GCCAGGCCTCTGTGTGGGCAAGG - Intergenic
916608758 1:166369125-166369147 GCCTCCCCTCTTTGGGGGAGAGG - Intergenic
920549476 1:206846494-206846516 GACTCCCCTCTGGGTAGGGCTGG - Intergenic
922780226 1:228246619-228246641 ACGTCACCTCTGTCTGGGCCTGG - Exonic
922780671 1:228250056-228250078 ACGTCACCTCTGTCTGGGCCTGG - Exonic
922782511 1:228264207-228264229 ACGTCACCTCTGTCTGGGCCTGG - Exonic
922783034 1:228268621-228268643 ACGTCACCTCTGTCTGGGCCTGG - Exonic
922785711 1:228281373-228281395 GCCCCCTCTGTGTGTGTGCCCGG + Intronic
923859156 1:237875659-237875681 GCCTCCCCTCTGTGAGGGAAGGG + Intergenic
1063091910 10:2872923-2872945 GCTTCCCCTCTGAGTGAGGCAGG + Intergenic
1064014403 10:11761435-11761457 GCCTCCCCTGTGTGTGTCTCCGG + Intronic
1066332731 10:34442493-34442515 GCCTCGCCTCCTTGTGCGCCAGG - Intronic
1067030970 10:42878700-42878722 GCCTCCCCTCTCTCCGGGACGGG - Intergenic
1067582099 10:47452422-47452444 GCTTCCCCTCTGTGGGAGACGGG - Intergenic
1067770645 10:49121234-49121256 GTCTTCTCTCTGTGTGTGCCTGG + Intergenic
1068670342 10:59716047-59716069 GCCTGCCTTCTGCGTGGGCTTGG - Intronic
1068910667 10:62374969-62374991 GGTTCCCCTCTCTGGGGGCCGGG + Intronic
1070156596 10:73839447-73839469 GCCTCCCTGGTGAGTGGGCCCGG + Intronic
1070793428 10:79203165-79203187 GCCTTCCCTCCTTGAGGGCCAGG + Intronic
1072249029 10:93567291-93567313 AGCGCCCCTCTGTGTGTGCCGGG + Intronic
1072522696 10:96242479-96242501 GCCTCAGATCTGTGTGTGCCTGG + Intronic
1073131336 10:101190950-101190972 ACCTCCTCTCTGTCTGGCCCAGG + Intergenic
1073257144 10:102160043-102160065 GCCTCCCCTCAGCGTGGGTCTGG + Intronic
1073541823 10:104321309-104321331 GCCGCCCCTCTCTGTGGACAAGG - Intronic
1075547190 10:123363898-123363920 TCCTCCCTTCTGTGTGGTCAAGG - Intergenic
1076819351 10:132930922-132930944 GCCTAGCCTCTGTGTGGGGAAGG - Intronic
1076819523 10:132931515-132931537 GCCTAGCCTCTGTGTGGGGAGGG - Intronic
1076819696 10:132932136-132932158 GCCTAGCCTCTGTGTGGGGAAGG - Intronic
1076874547 10:133209687-133209709 GCTTCCCCGCTCTGTGGACCTGG + Intronic
1077192818 11:1262552-1262574 GCCTCCCCGCTGACCGGGCCTGG - Intergenic
1077383801 11:2259698-2259720 GTCCCAGCTCTGTGTGGGCCTGG + Intergenic
1078402258 11:11038618-11038640 GCATCCCCGCTCTGAGGGCCTGG - Intergenic
1078446709 11:11410074-11410096 TCCTCCCCTGTGGGAGGGCCAGG - Intronic
1078535165 11:12167354-12167376 CCCTCCCCTGTGTGTAGCCCAGG + Intronic
1079560875 11:21817920-21817942 GTTTCCCTTCTGTGTGGGGCTGG - Intergenic
1079709745 11:23666480-23666502 GCTTCCCCTCTATGGGGGCTGGG - Intergenic
1081391021 11:42528933-42528955 GCCTCTCCTCTGTGTGTCTCAGG - Intergenic
1081968472 11:47183417-47183439 GCCTGGCTTCTGTGTTGGCCAGG + Intronic
1082810007 11:57474085-57474107 GCCTACCCCCTGGATGGGCCTGG + Intronic
1083147086 11:60767750-60767772 GCCTCTCCTAGGTGGGGGCCTGG + Intronic
1083685852 11:64374677-64374699 GCCTCTTCTCTGTGTGGTCAAGG + Intergenic
1083718871 11:64594142-64594164 GCCCCTCCTCTGTGTGTGCCAGG + Intronic
1083804943 11:65067866-65067888 GCCTCCTCTCTGCACGGGCCAGG + Intronic
1083957371 11:65992287-65992309 GCCACCCCTGTGTGTGTGCCAGG - Intergenic
1084090951 11:66879112-66879134 GCCTTCCAGCTGTGTGGGGCCGG - Intronic
1084165261 11:67372544-67372566 GCCTTCCCCCTGTGTGGCCTCGG + Intronic
1084377031 11:68784606-68784628 GCCACCCCTGTGTGTGTGTCAGG - Intronic
1089127377 11:116186220-116186242 GCCTCTCCTCCTTGTGCGCCAGG - Intergenic
1089604706 11:119635201-119635223 AAGGCCCCTCTGTGTGGGCCAGG - Intronic
1090498017 11:127233551-127233573 CCCTGCCCTCTCTGTGTGCCTGG + Intergenic
1091115388 11:133007731-133007753 TTCACCACTCTGTGTGGGCCTGG - Intronic
1091398482 12:168951-168973 GCCTCGCCTCTGTGTGGTTGAGG + Intronic
1091890300 12:4048392-4048414 ACTTCCCATCTGTGTGAGCCAGG + Intergenic
1094118343 12:26941314-26941336 GCTTCCCCTCTTTTTTGGCCAGG - Intronic
1094837816 12:34330378-34330400 GCATCCCCTGTGAGTGGCCCCGG - Intergenic
1094856806 12:34406525-34406547 GCCTCCCCACTGTGTATGCATGG + Intergenic
1095342740 12:41111158-41111180 GCCTCTTCTCTGTGTGGGAGTGG + Intergenic
1097997919 12:65910137-65910159 ACCTCCCCTCTTTGTGTTCCAGG + Intronic
1102034073 12:109760999-109761021 GCCTGCCCTCAGTGGGGGCATGG - Intronic
1102298720 12:111756311-111756333 CCCTCCACTCTGTGTCTGCCAGG + Exonic
1102797353 12:115700351-115700373 ACCTCCCATCTGTGTGGGAAGGG - Intergenic
1104887938 12:132122432-132122454 GCCTGGCCTCGGTGTGGGTCAGG - Intronic
1104991214 12:132624839-132624861 GCCTCCTCTCTGAGTGGACTGGG - Intronic
1105628797 13:22140638-22140660 GGCTCCCCTCAGTGTGGGTTTGG + Intergenic
1106587507 13:31070053-31070075 TCCTCCCCAGTGGGTGGGCCTGG - Intergenic
1111120897 13:83847501-83847523 ACTTCCTCTCTGTGTGAGCCCGG - Intergenic
1111507506 13:89213142-89213164 GCCTCGCCTCCTTGTGCGCCAGG + Intergenic
1112491008 13:99863826-99863848 TCCTGCCCTCTGTGGGGGCTGGG - Intronic
1112494342 13:99893686-99893708 GAGGCCCCTCTGTGTGGGGCTGG - Exonic
1113797378 13:113066325-113066347 TCCGAGCCTCTGTGTGGGCCTGG + Intronic
1114200635 14:20516759-20516781 GCCTCTACTGTGTGTGGCCCTGG - Intergenic
1116774853 14:49167531-49167553 GCCTGTCCTGTGTGGGGGCCAGG - Intergenic
1117070222 14:52049440-52049462 ACCTCCCCTGTGTCTGGCCCAGG - Intronic
1118014071 14:61640628-61640650 GCCTCCCACCTGTGTCAGCCTGG + Intronic
1118543444 14:66857974-66857996 GGTTCCCCTCTGTGTAGGGCTGG - Intronic
1118751199 14:68808861-68808883 TCCTCCACAGTGTGTGGGCCTGG - Intergenic
1119598335 14:75957104-75957126 GCATCCCCTCTCTGTGCCCCCGG + Intronic
1121581413 14:95034981-95035003 TCCACCCCTCCTTGTGGGCCTGG - Intergenic
1122297331 14:100712838-100712860 GCCTCCCTGCTGGGTGGCCCTGG - Intergenic
1122374670 14:101249842-101249864 TGCTCCGCTCTGTGTGGACCAGG + Intergenic
1123827870 15:24101522-24101544 GCCTCACCTGTGTGGGCGCCAGG - Intergenic
1123857358 15:24426992-24427014 GCCTCACCTGTGTGGGCGCCAGG - Intergenic
1128704042 15:69825659-69825681 TCCTCCTCACTGTGTGGCCCTGG - Intergenic
1129726914 15:77906098-77906120 CCCTCCTCCCTGAGTGGGCCAGG - Intergenic
1129739687 15:77984273-77984295 GCCTCCCCTCTGGCTGTGCCTGG - Intronic
1129756666 15:78103084-78103106 CTCTCCCATCTCTGTGGGCCTGG + Intronic
1129942087 15:79507016-79507038 GCCTTTCCTCTGTGTGTGCATGG + Intergenic
1130274911 15:82471354-82471376 CCCTCCTCCCTGAGTGGGCCAGG - Intergenic
1130467258 15:84198723-84198745 CCCTCCTCCCTGAGTGGGCCAGG - Intergenic
1130486340 15:84400453-84400475 CCCTCCTCCCTGAGTGGGCCAGG + Intergenic
1130497004 15:84474813-84474835 CCCTCCTCCCTGAGTGGGCCAGG + Intergenic
1130503725 15:84517023-84517045 CCCTCCCCTCTTAGTGGGCGGGG - Intergenic
1130589555 15:85203321-85203343 CCCTCCTCCCTGAGTGGGCCAGG - Intergenic
1130652903 15:85772393-85772415 GCCTCCCCTCTGGCAGGGCCAGG - Intronic
1132314661 15:100880724-100880746 GCCTCCTCGCTCTGTGGGCTGGG + Intronic
1132677098 16:1125334-1125356 GCCTCTCCTCACTGTGGCCCAGG + Intergenic
1132745227 16:1433632-1433654 GCCTCCCTTTTCTGTGGGCAGGG - Intergenic
1133040383 16:3057379-3057401 GACTCACCTGTGTGTGGGCGAGG - Exonic
1133595113 16:7283526-7283548 ACCTCCCCTCTGTGTTGGCCAGG + Intronic
1134337817 16:13317586-13317608 GCCTACCCTCTGGGTGACCCTGG + Intergenic
1136413679 16:30091301-30091323 CCCTCCCCTCTTTGGGGCCCTGG + Intronic
1136414519 16:30095467-30095489 GCCTCGCATGTGTGTGGCCCAGG - Exonic
1137716248 16:50600071-50600093 GCCTGACCACTGTGGGGGCCAGG + Intronic
1138116370 16:54363952-54363974 GCCTCCCATCTGTGTGTGTGAGG + Intergenic
1138284393 16:55797770-55797792 GTCTCCCCTCTCTCTGGACCAGG - Intergenic
1138284609 16:55799217-55799239 GTCTCCCCTCTCTCTGGACCAGG + Intergenic
1140224894 16:73069109-73069131 GCAACCTCTCCGTGTGGGCCTGG - Intergenic
1140339741 16:74146103-74146125 GCCTGCCCTCTGTTGTGGCCTGG - Intergenic
1141288926 16:82699420-82699442 GCCTCCTCTCAGTCTGGGCTGGG - Intronic
1141484906 16:84332318-84332340 GCCTCCCTCGTGTCTGGGCCTGG - Intergenic
1141704008 16:85654902-85654924 GCCTCCCCTCGGCCTGGACCCGG + Exonic
1142206359 16:88784982-88785004 GCGTCCGCTCGGTCTGGGCCGGG - Exonic
1142235603 16:88921093-88921115 GCCTCCGCCCTGTGAGAGCCGGG - Intronic
1142375717 16:89706208-89706230 GCCTGCACACTGTGGGGGCCGGG - Intergenic
1142713480 17:1735945-1735967 GCCTTCCTGCTGTGTGGGCTTGG + Intronic
1143963346 17:10738604-10738626 GCCTTTCCTCTGTGTGGGCCAGG - Intergenic
1146513256 17:33469012-33469034 GCCTCCCTTCTCTGGGGCCCAGG - Intronic
1147959410 17:44157347-44157369 GCCTCCCTTCAGCATGGGCCTGG + Intronic
1148003961 17:44409787-44409809 CCCTTCCCTCCGTGTGGGGCAGG + Intronic
1151132393 17:71910782-71910804 GCCTTCCCTCTGCATGCGCCTGG + Intergenic
1151540537 17:74762495-74762517 GCCACCCCACTCTGTGTGCCTGG - Intronic
1151804538 17:76397302-76397324 TCCTGCCCCCTGTGTGGACCAGG + Intronic
1151982131 17:77519338-77519360 GCCTCCACTCTGTGCTGGGCTGG + Intergenic
1152537608 17:80959767-80959789 GCCTCCGCTCGGGGTGGGGCTGG + Intronic
1152629381 17:81403239-81403261 GCCTCCCCTCTCCAGGGGCCAGG + Intronic
1152638786 17:81440947-81440969 GCCTCTCCTCTGGGGGCGCCAGG + Intronic
1153001126 18:456410-456432 GCGTCTCATCTGTGTGGGCCTGG - Intronic
1157311323 18:46555521-46555543 GGCTCCCCTCTGTGCAGGGCAGG - Intronic
1160530029 18:79557310-79557332 GCCTGCCCTCTCTGTAGACCTGG - Intergenic
1160820264 19:1054578-1054600 GCCTGCCCTCTTTGTGGGCCTGG + Exonic
1160951956 19:1672052-1672074 CCCTCCCCTCCCTGTGGTCCGGG + Intergenic
1161300078 19:3538212-3538234 GCCCCTCCTCTGGCTGGGCCCGG - Intronic
1161474573 19:4477134-4477156 GCCTCTCCTTTGTTTCGGCCTGG + Intronic
1162031994 19:7921527-7921549 GCCTCACCTCTATGGGGGCTGGG - Exonic
1162368018 19:10261172-10261194 GCCTTCTGCCTGTGTGGGCCTGG + Intergenic
1162568555 19:11457600-11457622 GTCTCTGCTCTGTTTGGGCCAGG + Intronic
1163832192 19:19552439-19552461 ACCTCCCATCTGTGTGGCCAAGG - Intergenic
1164708425 19:30337247-30337269 GCAACCCCACTCTGTGGGCCAGG - Intronic
1164711099 19:30357744-30357766 GCCTCCCAGCTGTGGGCGCCTGG + Intronic
1165243505 19:34484428-34484450 GCCTCCCATCTGTGAGGTCATGG + Intronic
1165308862 19:35018826-35018848 GCCACCCCTGAGTGGGGGCCTGG + Intronic
1165998653 19:39863906-39863928 GCCTCACCTCTGTGTTTGCTGGG - Intronic
1166380033 19:42350985-42351007 GCACCCCTTCTGTGTGGTCCGGG - Intronic
1166739496 19:45105367-45105389 GCTTGCCCTCTCTGTGGGGCAGG + Intronic
1167393572 19:49212254-49212276 GCCTCAACCCTGTGTGCGCCTGG - Intergenic
1167898148 19:52598401-52598423 AGCTCCCCTCTGTCTGGGGCAGG + Intronic
1168648790 19:58079565-58079587 GCCTTTCCTCTGTGTGTGCATGG + Intronic
926168253 2:10534913-10534935 GCCTCCCGTGTGACTGGGCCAGG + Intergenic
927893250 2:26765404-26765426 GCCTCCCCTCTGTTGTGGGCAGG + Intronic
928123922 2:28603137-28603159 CCCTCCCCTCTGTGGCTGCCTGG - Intronic
929943077 2:46349513-46349535 GCCTGCCCTCTGGCTGGGCTCGG + Intronic
931434673 2:62236188-62236210 CCTTCCCCTCTGGGCGGGCCAGG - Intergenic
932420921 2:71600896-71600918 GCCAACCCTCTGTGGGAGCCTGG + Intronic
932794031 2:74679858-74679880 CCGCCCCCACTGTGTGGGCCCGG - Exonic
935576677 2:104718111-104718133 GATTCCCCTCTGTGTAGGGCTGG + Intergenic
936013879 2:108943302-108943324 GCCTCCCCTCTGTTTCTCCCAGG - Intronic
936073470 2:109386594-109386616 GCTTCCCTTCTGTTTGGGCCCGG + Intronic
936146204 2:109981957-109981979 GCCCCTCCTCTCTCTGGGCCTGG + Intergenic
936156389 2:110050034-110050056 GCCTGGGCTCTGGGTGGGCCTGG - Intergenic
936188301 2:110321410-110321432 GCCTGGGCTCTGGGTGGGCCTGG + Intergenic
936198487 2:110389522-110389544 GCCCCTCCTCTCTCTGGGCCTGG - Intergenic
938065317 2:128279033-128279055 GCCTCCCCGCTGCATGGGACAGG + Intronic
938069546 2:128301142-128301164 GCCGCCCCTCTGTGTGGGACTGG + Intronic
938069562 2:128301190-128301212 GCCACTCCTCTGTGAGGGGCAGG + Intronic
938069574 2:128301238-128301260 GCCACCCCTCTGTGTGAGGCAGG + Intronic
938109573 2:128554828-128554850 GCCTCCCGTATGTGTGGCCTGGG + Intergenic
938378328 2:130823039-130823061 GCCTCAGCTCAGGGTGGGCCTGG + Intergenic
940288961 2:152059276-152059298 GCCTGCACTGTGTGTGTGCCTGG + Intronic
942063299 2:172247692-172247714 GCCTCAGCTCAGTGTGGCCCTGG - Intergenic
943661482 2:190563875-190563897 GCCTCCCTACTCTGTGGGGCTGG + Intergenic
943960591 2:194257578-194257600 GCCTCCTCACTGTGTTGGCCAGG - Intergenic
946734412 2:222740185-222740207 GCCCTCCCTGTGTGTGGGCGGGG - Intergenic
947850813 2:233286315-233286337 GCCTCCCCACTTTGAGGCCCCGG + Intronic
948297898 2:236876366-236876388 GCCTCTCCAGTGTGTGGTCCAGG + Intergenic
948818382 2:240525586-240525608 TCCTCCCTCCTGTGTGGACCAGG - Intronic
1171170679 20:23012582-23012604 GCCTACCCTGTGTGTAGACCTGG - Intergenic
1173590684 20:44222455-44222477 CCCACCCCTCTGTGTGGCCTTGG + Intergenic
1174338844 20:49883498-49883520 GCCCTCCCTGTGTGTGCGCCAGG - Intronic
1174367382 20:50064712-50064734 GCGGCCCCTCTGTGTGTGCCTGG - Intergenic
1174412242 20:50343683-50343705 GCCGCCCCGCGGTGTGTGCCAGG + Intergenic
1175230686 20:57471518-57471540 GTCTGCCTTCTGAGTGGGCCCGG + Intergenic
1175978327 20:62724755-62724777 GCCTCCGCGGAGTGTGGGCCTGG - Intronic
1176099773 20:63359658-63359680 GCCGCTCCTCGGCGTGGGCCCGG + Exonic
1176943700 21:14954022-14954044 GCCTCCACTCTAGGTGTGCCAGG + Intergenic
1177655502 21:24011351-24011373 GACTCCCTCCTGAGTGGGCCTGG - Intergenic
1177805255 21:25868940-25868962 CGCTTCCCTCTGTGTGGCCCTGG + Intergenic
1178704976 21:34865608-34865630 GCCTCCCCGCTGACTGGCCCTGG - Intronic
1179465190 21:41567267-41567289 GCTTTCCCTCTGAGTGGGACGGG - Intergenic
1179486208 21:41712347-41712369 CCCTCCCCTCTGGGTGAGCCTGG - Intergenic
1179674734 21:42974092-42974114 GCCTCCGTTCTGTGTGTGCCCGG - Intergenic
1179722843 21:43325188-43325210 GCCTGCCCCCTGGGTGGGCAGGG + Intergenic
1180595779 22:16972322-16972344 GCCTTCCATCTGAGTGAGCCCGG + Intronic
1180876796 22:19178525-19178547 GCCGCGCTTCTGGGTGGGCCCGG - Intronic
1180932032 22:19598691-19598713 GCCTCACCACAGTGTGGGCAGGG + Intergenic
1180995674 22:19964063-19964085 GCCTCCTGTCTGTGTGGGCGTGG + Intronic
1181014611 22:20061901-20061923 GCCTCCCCTGGGCCTGGGCCTGG - Intronic
1181473337 22:23154066-23154088 GCCTTCCATCTGAGTGGCCCAGG + Intronic
1182359535 22:29738433-29738455 GCCTCTCCTCTGTGGGGACAGGG + Exonic
1183484440 22:38081725-38081747 CCCTCCCTCCTGTGGGGGCCAGG - Intronic
1183505601 22:38207059-38207081 ACCTCCTCCCTGTGTGGCCCTGG - Intronic
1183609712 22:38891434-38891456 CCCTCCCATCTGTCTGGGCTGGG + Intergenic
1183661632 22:39224890-39224912 GCCTCCCCTCAGAGCTGGCCAGG + Exonic
1183779468 22:39989521-39989543 GCCTCTCCTCCCAGTGGGCCTGG + Intergenic
1184177068 22:42794498-42794520 GCCTCCCCTCTGACTGCCCCTGG + Intergenic
1184458324 22:44623933-44623955 GCCTGCCCTCTCTGTGTGCTGGG + Intergenic
1184832487 22:46997727-46997749 GCAGCCCCTCTCTGTGGGCGGGG + Intronic
1185373457 22:50471301-50471323 GCCTGCCGTCTGCGTGGGGCTGG - Intronic
950099059 3:10346164-10346186 GCCTCCCACCTGAGTGGCCCAGG - Intronic
950126077 3:10510577-10510599 GGCTCCCACCTGTGTGGGGCAGG + Intronic
950127478 3:10518808-10518830 GTCTCCCCTCTGTCGGGGACAGG + Intronic
950140683 3:10613028-10613050 CCCTCCCCTCGGTGGAGGCCAGG - Intronic
950911778 3:16603372-16603394 GCCTCCCCTCTTTGTTGCCTAGG + Intronic
950958624 3:17081109-17081131 GCATCCCCTCTTTGTGGAGCAGG + Intronic
952383060 3:32819001-32819023 TCCTCCCCTCGCTGTGGGACCGG - Intronic
954259180 3:49426286-49426308 CCCTCCTCACTGTGTGGGTCAGG + Exonic
954273946 3:49530554-49530576 GTCTCCCCACTGTGTGGCCTTGG + Intronic
954322805 3:49843531-49843553 GCATCCCCTCTGTGAGGTACTGG + Intronic
954405125 3:50341204-50341226 GCCTACCCACTGGGTGGGGCAGG + Exonic
954733507 3:52685679-52685701 GCCGGGCCTTTGTGTGGGCCCGG - Intronic
954806147 3:53222070-53222092 GCCTTGCCTCTGTGTGTGCTGGG - Intergenic
956165141 3:66392724-66392746 GCTTTCCCTCTGGGTGAGCCAGG - Intronic
958461276 3:94399568-94399590 GCCTTCCCTCTGTGTGCACATGG + Intergenic
960417471 3:117402148-117402170 GCCTCTCCTCTGTGTGTGGCTGG + Intergenic
961535256 3:127566842-127566864 GCCTCCCCACTGTGAGCACCTGG - Intergenic
962375610 3:134856330-134856352 GCCTCCCCTCAGTGTGAGTGGGG + Intronic
963084888 3:141427612-141427634 GTCTCCACTCTGTATTGGCCAGG + Intronic
963572012 3:147009240-147009262 GATTCCCCTCTGAGTAGGCCTGG + Intergenic
965685438 3:171297280-171297302 GTCTCCCCTCTCTATGGGCATGG - Intronic
966805211 3:183802247-183802269 GGCTCCCCTCTGAGTGTGCATGG - Intronic
968233396 3:197017132-197017154 GGCCCCCATCTGTGTCGGCCCGG + Exonic
968288222 3:197520442-197520464 GCCTCCCCTCTGTGTGGGCCGGG + Intronic
968745121 4:2356038-2356060 CCCTCCCCTCTGTGTGGCCTTGG + Intronic
968969523 4:3786314-3786336 GCCAGCCCTCTTTGTGGCCCTGG - Intergenic
969305762 4:6325466-6325488 GCCTCCCCACTGTGCTGGCGCGG - Intronic
969613546 4:8239930-8239952 CCCTGCCCTGTGTGTGGGGCGGG + Intronic
969676853 4:8619124-8619146 CACTTGCCTCTGTGTGGGCCTGG - Intronic
973276936 4:48319890-48319912 TTCTCCCCACTTTGTGGGCCAGG - Intergenic
973610698 4:52633841-52633863 GCCTCCTGCCTGAGTGGGCCAGG - Intronic
973981864 4:56314477-56314499 GCCTCTCCTCCGCTTGGGCCTGG - Exonic
976146159 4:82044298-82044320 GCCTCCGCTCTGCGGGAGCCGGG + Intergenic
982309387 4:153968511-153968533 TCCTCACTTCTGTGTGGTCCTGG + Intergenic
985163334 4:187066258-187066280 GCCTTCTCTCTGTGTGTGCATGG - Intergenic
985515686 5:343655-343677 GCCTCCCCTCGGTGTCAGGCGGG - Intronic
985783251 5:1881695-1881717 GCCTCCCCTCTGTGACAGTCCGG + Intronic
986523122 5:8642973-8642995 TACTCCCCACTGTGTGGGCCAGG + Intergenic
986703549 5:10435325-10435347 GCCTCGCCTCCTTGTGTGCCAGG - Exonic
988847388 5:35141917-35141939 TCCTCCACTCTGTGAGGGCAGGG + Intronic
995160046 5:108968359-108968381 GTCTCCTCTCTCTGTGGCCCAGG - Intronic
997519349 5:134512638-134512660 GGCTGCCCTCTGTGTGGCCTGGG - Intergenic
997578910 5:135005047-135005069 CCCTCCTCCCTGTGTGGTCCTGG - Intronic
999299394 5:150481825-150481847 GCCACCTCCCTGGGTGGGCCCGG + Intergenic
1001246855 5:170111345-170111367 GGCTCCCCTCTGGGTTGGCTTGG - Intergenic
1001777128 5:174337352-174337374 GGCTCCACTGTGTGTGGCCCTGG + Intergenic
1002173034 5:177385938-177385960 GCCTCCCCACTTTGGGGCCCTGG + Intronic
1002553129 5:180012451-180012473 GCTTCCCCGGTGTGAGGGCCTGG - Intronic
1002600737 5:180352928-180352950 CCCTCCCCTCCGTGGGGACCGGG + Intronic
1002833276 6:843648-843670 GCCTTTCCTCTGCGTGTGCCTGG + Intergenic
1003223802 6:4186927-4186949 GCTTCCCCTCTGTGTTGTCTGGG - Intergenic
1005173269 6:23012734-23012756 TCCTCCCCTCTGTGTTTGCACGG - Intergenic
1005916110 6:30352960-30352982 TCCTCCCATCTGCCTGGGCCTGG + Intergenic
1006193006 6:32220931-32220953 GCCGCCCCTCTCTCTGGGCAGGG - Intronic
1016753032 6:147651914-147651936 ACCCCCACTCTGTGCGGGCCTGG - Intronic
1016937068 6:149455367-149455389 TCCTCAGCTCTGTGAGGGCCGGG - Intronic
1017693665 6:156992625-156992647 GCCTCCCATCTGTGGGGCCTGGG + Intronic
1018770927 6:166970980-166971002 GCCTCACCCCTGGGTGGCCCCGG + Intergenic
1019505288 7:1387428-1387450 GCCTCCCACCTGTGGGGGCCAGG + Intergenic
1019709163 7:2510557-2510579 GCCGCCCCTCTGTGTCTGCCTGG - Intergenic
1020139282 7:5603841-5603863 GACTCCCCTCTTTCTGGGACAGG + Exonic
1020756263 7:12207484-12207506 GACACCCCTGTGTGTGGACCAGG - Intergenic
1023296551 7:38721121-38721143 GCCACACCTCTGTCTGGGCTGGG - Intergenic
1023496195 7:40800000-40800022 GGCTCCACTCACTGTGGGCCTGG + Intronic
1024058277 7:45679995-45680017 GCCTGCCCTCTGGGTGGGATGGG + Intronic
1024132584 7:46370125-46370147 GCCTCACCTGTCTGTGGACCTGG + Intergenic
1024133596 7:46383655-46383677 GCCTCACCTCTCTTTGGCCCTGG - Intergenic
1024209757 7:47192975-47192997 CCCTCCCCTCTGTGCTTGCCTGG - Intergenic
1024855935 7:53779183-53779205 CCCTCTCCTCTTTGTGTGCCAGG - Intergenic
1024949209 7:54840605-54840627 TCTTCCTCTCTGTGTGGTCCTGG - Intergenic
1024961612 7:54982098-54982120 CCCTCCCCTTCGTGTGGGCTGGG - Intergenic
1028882032 7:95891110-95891132 GGCTTTCCTCTGTGTGTGCCTGG - Intronic
1028978068 7:96936068-96936090 GCCTTTCCTCTCTGTGTGCCTGG - Intergenic
1032456377 7:132076210-132076232 ACCTCCCCTCTGTGCTGACCTGG + Intergenic
1032457188 7:132082144-132082166 GCTTCCTGTCTGTGTGGGCCTGG + Intergenic
1034503826 7:151469509-151469531 GCCTCCTCCCTGGGAGGGCCGGG - Intronic
1035414426 7:158671065-158671087 TCCTTCACTCTGTGTGGGGCAGG + Intronic
1035414449 7:158671147-158671169 TCCTTCACTCTGTGTGGGGCAGG + Intronic
1035617958 8:1016292-1016314 GCCTCCACTGTGTGTGTGACCGG + Intergenic
1035618072 8:1017132-1017154 GCCTCCACTGTGTGTGTGACCGG + Intergenic
1035618139 8:1017614-1017636 GCCTCCACTGTGTGTGTGACCGG + Intergenic
1035993268 8:4516199-4516221 GTCTTCCCTCTGTGTGTGTCTGG - Intronic
1040275667 8:46012452-46012474 GCATCTACTCTGTGTGGCCCGGG - Intergenic
1040279653 8:46032807-46032829 GCCCACCCTCTGTTTGGTCCGGG + Intergenic
1040701818 8:50075144-50075166 GCCTCCCCCCTGTGGGCTCCTGG + Intronic
1040811266 8:51456258-51456280 GCCTCTCCTCTGTATGCTCCAGG + Intronic
1043940665 8:86191979-86192001 GACTCCCCTCTGTGTGAGAGTGG - Intergenic
1047707710 8:127517371-127517393 GCCTTCCCTCTGTGTGTGCATGG + Intergenic
1049592344 8:143468353-143468375 TCCTGCCCTCGCTGTGGGCCTGG - Intronic
1049683702 8:143930863-143930885 CCCACCCCTCTGCGGGGGCCAGG + Intronic
1049803267 8:144527843-144527865 GCCTGCCCTCGGTATGGTCCTGG - Intronic
1049812662 8:144582425-144582447 GCCGCCACTGTGTGAGGGCCCGG - Intronic
1050930270 9:11313331-11313353 GATTCCTCTCTGTGTAGGCCTGG + Intergenic
1052981893 9:34456308-34456330 GCTTCCGGTCTGTGTGGCCCTGG - Intronic
1053273878 9:36768918-36768940 GCCACCCAGCTGTGTGGGCCTGG - Intergenic
1053510401 9:38682991-38683013 TCCTCCCCTCCTTGGGGGCCAGG - Intergenic
1055342333 9:75297064-75297086 GTCTCCCCTCTGTGTGTGTCTGG + Intergenic
1057297746 9:93859434-93859456 GCCTCTCTCCTGTGGGGGCCAGG - Intergenic
1057568896 9:96188789-96188811 GCCAAGCCTCTGTGTGGGCAGGG - Intergenic
1059550308 9:115222401-115222423 TCCTCTCCTCTGTCTGTGCCTGG - Intronic
1059628759 9:116096612-116096634 GCATCCCTTCTGTATGGGTCAGG + Intergenic
1060475327 9:123982679-123982701 GCCAACCTGCTGTGTGGGCCTGG - Intergenic
1061359896 9:130134423-130134445 GCCTCCACTCTGTGAGCTCCCGG - Intronic
1061395915 9:130343249-130343271 GCCTCCCCTCTGTGGGGCTGAGG + Intronic
1061420835 9:130472183-130472205 GCCTCCCCGGGGTGTGGGGCTGG - Intronic
1061923859 9:133796590-133796612 GTCTCCCCTCTCTGTGGGCGGGG - Intronic
1062354025 9:136153461-136153483 GCCTCACCGCTGGGTGGGGCAGG - Intergenic
1062624084 9:137435175-137435197 GCCTCCCCTGGGCGTGGGCGGGG - Intronic
1185468149 X:368103-368125 GCCTTCCCTGTGTCTGTGCCCGG - Intronic
1190264411 X:48818947-48818969 GCCTTCCCTCTGTGTGAGCTAGG + Intronic
1190339515 X:49285948-49285970 TCCTCCCCTCTCTGTGGCCTGGG + Exonic
1193207142 X:78762513-78762535 TCCTTCCCTCTCTGAGGGCCTGG + Intergenic
1195096694 X:101508439-101508461 GCCTTTTCTCTGTGTGGGCGTGG + Intronic
1196253269 X:113486412-113486434 GATTCCCCTCTGTCTGGGGCTGG + Intergenic
1198137792 X:133771417-133771439 AGGGCCCCTCTGTGTGGGCCTGG + Intronic
1198994008 X:142552266-142552288 GCCTCACCTCCCTGTGTGCCAGG - Intergenic
1199187806 X:144938038-144938060 ACCTCCCTTTTGTGGGGGCCTGG - Intergenic
1199952248 X:152715625-152715647 GCATCCCTTCTTTCTGGGCCGGG - Intronic
1199954883 X:152734816-152734838 GCATCCCTTCTTTCTGGGCCGGG - Intronic
1199957435 X:152752823-152752845 GCATCCCTTCTTTCTGGGCCGGG + Intronic
1201077052 Y:10196492-10196514 GCCGCCCCTCTGTGGGCTCCCGG + Intergenic
1202368877 Y:24184298-24184320 TCCTCCTCCCTGAGTGGGCCAGG + Intergenic
1202501908 Y:25485819-25485841 TCCTCCTCCCTGAGTGGGCCAGG - Intergenic