ID: 968288378

View in Genome Browser
Species Human (GRCh38)
Location 3:197521277-197521299
Sequence TAGAATACAGCAGTGGGGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 426
Summary {0: 1, 1: 1, 2: 2, 3: 30, 4: 392}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968288378_968288384 -4 Left 968288378 3:197521277-197521299 CCATCCCCCACTGCTGTATTCTA 0: 1
1: 1
2: 2
3: 30
4: 392
Right 968288384 3:197521296-197521318 TCTACATGAATGGCACCCCGAGG 0: 1
1: 1
2: 0
3: 9
4: 67
968288378_968288388 22 Left 968288378 3:197521277-197521299 CCATCCCCCACTGCTGTATTCTA 0: 1
1: 1
2: 2
3: 30
4: 392
Right 968288388 3:197521322-197521344 CAGACAGAGCTCCTCCCACAAGG 0: 1
1: 0
2: 6
3: 23
4: 280

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968288378 Original CRISPR TAGAATACAGCAGTGGGGGA TGG (reversed) Intronic
900508229 1:3040881-3040903 TGTAATACAGCTGTGGGGGCAGG - Intergenic
900862768 1:5245004-5245026 GAGAAGACAGAAGTGAGGGAAGG + Intergenic
902535577 1:17117895-17117917 AAGAACACAGCAGTGGAGGGTGG - Intronic
902947735 1:19854408-19854430 AAGAATTAAGCAGTGGGGAATGG - Intergenic
904049572 1:27631185-27631207 GAGAACACAGCAGTGGGGGAGGG - Intronic
904587285 1:31587302-31587324 AAGAATACAGGAGTGGGGTGGGG - Exonic
905261120 1:36719863-36719885 GAGAATGCAGCAGTGGGGTGGGG + Intergenic
905986193 1:42285268-42285290 TAAAATACAGGGGTGGGGTAGGG - Intronic
907273829 1:53306010-53306032 TAGAATAGAGAAGGGGAGGAGGG - Intronic
908112356 1:60909895-60909917 GAGAATACAGTAGGGGGAGAAGG + Intronic
909292825 1:73905772-73905794 TAGAATAGAGCACTGAGTGAGGG - Intergenic
909498309 1:76304497-76304519 TAGAATACAGCAAGGGGGCCAGG + Intronic
910232758 1:85003305-85003327 CAGAATCCAGGAGTGGGAGATGG + Intronic
911210564 1:95134302-95134324 TAGAATATAACAGTGAGGAAAGG + Intronic
911286715 1:96003375-96003397 AGGAACACAGAAGTGGGGGAAGG - Intergenic
913599278 1:120407335-120407357 AAGAAAAAAGCAGTGGGAGAAGG - Intergenic
914088101 1:144472285-144472307 AAGAAAAAAGCAGTGGGAGAAGG + Intergenic
914310513 1:146461924-146461946 AAGAAAAAAGCAGTGGGAGAAGG - Intergenic
914314666 1:146498828-146498850 AAGAAAAAAGCAGTGGGAGAAGG + Intergenic
914499685 1:148234560-148234582 AAGAAAAAAGCAGTGGGAGAAGG - Intergenic
914591597 1:149111217-149111239 AAGAAAAAAGCAGTGGGAGAAGG + Intergenic
915165810 1:153947068-153947090 TGGAATAGAGCAGTGGAGGTGGG + Intergenic
915875909 1:159612044-159612066 TGGAATATAGGAGTGGGGGCAGG + Intergenic
916045933 1:160999925-160999947 GAGAATACAGCTGTGAGGCACGG - Exonic
916909010 1:169324149-169324171 TAGAAGACTGAAGTGGGGGCTGG - Intronic
917403535 1:174678931-174678953 TGGCAAACAGCAGTGGTGGATGG + Intronic
917525175 1:175782040-175782062 GAGAAAAAGGCAGTGGGGGAGGG - Intergenic
917580203 1:176369340-176369362 TGGATTCCAGCAGTGGGGCAGGG + Intergenic
917724021 1:177812763-177812785 TGGCAAACAGCAGTGGTGGACGG - Intergenic
918129024 1:181608719-181608741 TAGAATAGAGGAGAGGGAGAAGG - Intronic
919082780 1:192886797-192886819 TGGCAAACAGCAGTGGTGGATGG + Intergenic
920029700 1:203029073-203029095 GGGGAAACAGCAGTGGGGGAAGG + Intronic
920219758 1:204388155-204388177 TTGGATACAGTAGTTGGGGAAGG - Intergenic
920732908 1:208504829-208504851 TAGAGAACAGCAGGTGGGGATGG - Intergenic
922723172 1:227909418-227909440 AAGAAAACAGAGGTGGGGGAAGG + Intergenic
923116813 1:230947963-230947985 TAGAATAGGGCAGTGGCTGATGG - Intronic
923566947 1:235083469-235083491 AAGAAAATAGCAGTGGGAGAAGG - Intergenic
923626448 1:235617569-235617591 TAGAAGATAGGAGTGGGGAAGGG - Intronic
924401763 1:243690724-243690746 TATAATATAGGGGTGGGGGAGGG + Intronic
1065625336 10:27624149-27624171 TTAAAAACAGCAGTGTGGGATGG + Intergenic
1066474033 10:35727365-35727387 TAAAATTGAGCAGTGGAGGATGG + Intergenic
1067350467 10:45471278-45471300 TATATTACAGCACTGGTGGAGGG + Intronic
1067965423 10:50907144-50907166 TAGTATACAGCAGTGGCCCAAGG - Intergenic
1068747991 10:60557033-60557055 CAGACGACAGCAGTGGGGGAGGG - Intronic
1069273810 10:66564819-66564841 TACAATAAATTAGTGGGGGAAGG + Intronic
1071529932 10:86381339-86381361 TGGATTTCAGCAGTTGGGGAGGG - Intergenic
1072267405 10:93743924-93743946 TTGAATAAGGCAGTGAGGGAGGG - Intergenic
1072378564 10:94841392-94841414 TGGCAAACAGCAGTGGTGGACGG + Intronic
1072472439 10:95724729-95724751 TGGCAAACAGCAGTGGTGGATGG + Intronic
1073762762 10:106648712-106648734 AATGATACAGAAGTGGGGGAAGG + Intronic
1074264462 10:111887765-111887787 TAGTCTAGAGCAATGGGGGAAGG + Intergenic
1074761759 10:116671892-116671914 TAGAATATTCCAGTGGGGGTAGG + Exonic
1074973333 10:118560968-118560990 GAGAAGACAGGGGTGGGGGAAGG - Intergenic
1075747442 10:124737516-124737538 GAGAACACAGCAGTAGGGCAGGG + Intronic
1076356421 10:129857015-129857037 CAGAGCCCAGCAGTGGGGGAAGG + Intronic
1077711131 11:4538222-4538244 AAAACTACAACAGTGGGGGAAGG - Intergenic
1077836795 11:5933281-5933303 AAGCACACAGGAGTGGGGGAAGG - Intronic
1077974384 11:7232438-7232460 TAGAATACAGCAGAGGTGATGGG + Intergenic
1078648182 11:13162145-13162167 TAGAATACAGCAGAGAGTGCAGG - Intergenic
1079678730 11:23265149-23265171 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1080881486 11:36325361-36325383 TAGCAAACGGCAGTGGTGGACGG + Intronic
1080907725 11:36563313-36563335 TAGAACAAAGAAGTGGAGGAAGG + Intronic
1080913568 11:36630834-36630856 TAGAATAGAGCACTGAGGCATGG + Intronic
1081070858 11:38606845-38606867 CAGCAAACAGCAGTGGTGGAAGG - Intergenic
1081728857 11:45354419-45354441 AAGAATACAGGAGGGAGGGAGGG - Intergenic
1081905639 11:46667790-46667812 TATCAAACAGCAGTGAGGGACGG + Exonic
1083214728 11:61211241-61211263 TAGAACAGAGCAGTCGGGGCTGG - Intronic
1083217612 11:61230070-61230092 TAGAACAGAGCAGTCGGGGCTGG - Intronic
1083616886 11:64030707-64030729 TACAAAACAGAAGTGGAGGAGGG + Intronic
1085556750 11:77430009-77430031 TAGAATACAGCAGTAGCAGTGGG + Intronic
1085621569 11:78041702-78041724 TGGCAAACAGCAGTGGTGGATGG - Intronic
1086922921 11:92607497-92607519 TAGTTTAAAGCAGTGAGGGAAGG - Intronic
1087283340 11:96237156-96237178 TAAAATACAGAACTCGGGGAGGG - Intronic
1088020694 11:105114817-105114839 TAGAATACAGCAGGAGAGGTGGG - Intergenic
1088150984 11:106744737-106744759 TAGAATGATGGAGTGGGGGATGG + Intronic
1088242923 11:107789629-107789651 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1088879797 11:113964486-113964508 CGGCAAACAGCAGTGGGGGATGG - Intergenic
1088901194 11:114118878-114118900 TAGATTACAACAGTGAGGAATGG + Intronic
1088986779 11:114916179-114916201 TAAAATACAGCTTTGGGGGCAGG - Intergenic
1089150475 11:116360073-116360095 TTGAATATAACAGTGTGGGATGG + Intergenic
1089678841 11:120108251-120108273 GCTAATACAGAAGTGGGGGAAGG + Intergenic
1089809771 11:121122120-121122142 TAGATCATAGCAATGGGGGAAGG - Intronic
1089961638 11:122622148-122622170 AAGAAAACAGCAGTGGGGAGAGG + Intergenic
1091220814 11:133928982-133929004 TAGACTACAGGAGGTGGGGAGGG + Intronic
1092953024 12:13525648-13525670 TGGAATGCAGCAGTGGGAAATGG + Intergenic
1092953082 12:13525975-13525997 TGGAATTCAGCAGTGGGAAATGG + Intergenic
1092953126 12:13526202-13526224 TGGAATGCAGCAGTGGGATAGGG + Intergenic
1092953139 12:13526285-13526307 TGGAATGCAGCAGTGGGAAATGG + Intergenic
1092953155 12:13526368-13526390 TGGAATGCAGGAGTGGGAGATGG + Intergenic
1092953169 12:13526450-13526472 TGGAATGCAGCAGAGGGAGATGG + Intergenic
1092953173 12:13526470-13526492 TGGAATGCAGGAGTGGGAGATGG + Intergenic
1092953180 12:13526511-13526533 TGGAATGCAGCAGAGGGAGATGG + Intergenic
1092953183 12:13526531-13526553 TGGAATGCAGCAGAGGGAGATGG + Intergenic
1092953186 12:13526551-13526573 TGGAATGCAGCAGAGGGAGATGG + Intergenic
1092953189 12:13526571-13526593 TGGAATGCAGCAGAGGGAGATGG + Intergenic
1092953193 12:13526591-13526613 TGGAATGCAGGAGTGGGAGATGG + Intergenic
1092953200 12:13526632-13526654 TGGAATGCAGCAGAGGGAGATGG + Intergenic
1092953203 12:13526652-13526674 TGGAATGCAGCAGAGGGAGATGG + Intergenic
1092953206 12:13526672-13526694 TGGAATGCAGCAGAGGGAGATGG + Intergenic
1092953212 12:13526712-13526734 TGGAATGCAGCAGAGGGAGATGG + Intergenic
1092953216 12:13526732-13526754 TGGAATGCAGGAGTGGGAGATGG + Intergenic
1093106666 12:15095461-15095483 TGGCAAACAGCAGTGGTGGACGG + Intergenic
1093156119 12:15688339-15688361 AATAATACAGAAGTGGGGAAAGG + Intronic
1094276386 12:28680883-28680905 TAAAATACAGGACTGTGGGATGG - Intergenic
1094640992 12:32275642-32275664 TGGCAAACAGCAGTGGTGGACGG - Intronic
1094701611 12:32875779-32875801 TAGACTACAGCAGGAGGAGATGG + Intronic
1095893114 12:47253062-47253084 TGGCAGACAGCAGTGGTGGATGG + Intergenic
1096352553 12:50912232-50912254 TGGAAAACAGCAGTGATGGACGG + Intergenic
1096488200 12:51998105-51998127 CAGGATAGTGCAGTGGGGGAAGG - Intergenic
1097131209 12:56811784-56811806 AACAATACAGAAGTGGGGAAGGG - Intergenic
1097817726 12:64093911-64093933 TCCAATTAAGCAGTGGGGGAAGG - Intronic
1098984869 12:77001448-77001470 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1101061584 12:100978090-100978112 TAGATTACAGCACAGGGTGATGG - Intronic
1102109888 12:110357054-110357076 TAGAATGCAGCAGAAGGTGAGGG + Intergenic
1103039811 12:117685662-117685684 TAGAAGACAGCAGAGGGGAGGGG + Intronic
1103168221 12:118789290-118789312 CAGGAAACAGCAGTGGGTGATGG - Intergenic
1104664580 12:130638659-130638681 TAGAAGACAACAGATGGGGAGGG - Intronic
1104851969 12:131880556-131880578 TGGCATTCAGCAGTGGTGGACGG + Intergenic
1105500536 13:20967727-20967749 CAGAATACAGGAGTTGGGGTAGG - Intergenic
1107156430 13:37172407-37172429 CAGCAAACAGCAGTGGCGGAGGG + Intergenic
1107410273 13:40151862-40151884 TAGAACACAGCCCTTGGGGAGGG + Intergenic
1107645280 13:42488288-42488310 TAGAATATAGGAGTGGAGAATGG + Intergenic
1107837554 13:44423790-44423812 CTGAATCCAGCAGTGGGGTAAGG - Intergenic
1108876192 13:55054003-55054025 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1108877212 13:55061318-55061340 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1109393506 13:61724305-61724327 TAGCATTCAGCAGTGGGTGTGGG + Intergenic
1110987077 13:81984444-81984466 TAGCAAACAGCAGTGGTGGATGG + Intergenic
1111910276 13:94303076-94303098 CAGCAAACAGCAGTGGTGGATGG + Intronic
1113416756 13:110134443-110134465 TAGAATACAAAAGTGGAAGAAGG + Intergenic
1114383847 14:22236732-22236754 TGGCAAACAGCAGTGGTGGATGG - Intergenic
1114384823 14:22243779-22243801 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1115156769 14:30349714-30349736 TAGAAGACAGCACAGTGGGAAGG - Intergenic
1116621333 14:47207627-47207649 TAGAATACAGCGCTTAGGGAGGG + Intronic
1117171807 14:53108124-53108146 TGGCAAACAGCAGTGGTGGATGG - Intronic
1117625549 14:57633997-57634019 TAGAATCCAGAAGTAGAGGAAGG + Intronic
1118046792 14:61978767-61978789 TGGACTAAAGCAGTGAGGGAGGG - Intergenic
1120107987 14:80517978-80518000 CAGCAAACAGCAGTGGTGGACGG + Intronic
1120820892 14:88910801-88910823 CAGAATACATCAGTGGGGTGTGG - Intergenic
1120880149 14:89409332-89409354 CAGAATCCAGCGGTGGGGGACGG + Intronic
1121952326 14:98182521-98182543 TATTATATAGCAGTGGGGGTTGG + Intergenic
1122367091 14:101200701-101200723 TACAATACAACACTGGGGGAAGG - Intergenic
1122684057 14:103490386-103490408 TAAAATACATCAGTGCGGGCCGG + Intronic
1123066334 14:105621255-105621277 GAGAATCCAGCAGTGTGGGCAGG + Intergenic
1123070477 14:105640307-105640329 GAGAATCCAGCAGTGTGGGCAGG + Intergenic
1123075067 14:105663967-105663989 GAGAATCCAGCAGTGTGGGCAGG + Intergenic
1123089713 14:105737095-105737117 GAGAATCCAGCAGTGTGGGCAGG + Intergenic
1124922604 15:34040947-34040969 TAGACCATAGCAGTGGGGAAGGG + Intronic
1126360651 15:47842470-47842492 TAGAACAAAGCAGTGTGGGAGGG + Intergenic
1126482444 15:49140964-49140986 AAGAAAACAGCAGAGGTGGATGG + Intronic
1126814204 15:52438858-52438880 TGGCAAACAGCAGTGGTGGACGG - Intronic
1127077181 15:55338303-55338325 TAGAATACAGCAGAAGGGATGGG + Intronic
1127913545 15:63437537-63437559 CAAAATACAGCATTAGGGGAGGG + Intergenic
1128363113 15:66976484-66976506 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1128904861 15:71457740-71457762 TAGAGTACAGTGGTGGTGGAGGG - Intronic
1129488639 15:75902588-75902610 TACTATCCACCAGTGGGGGAAGG + Intergenic
1130693580 15:86107656-86107678 TAGAATTCATCAGTGGGGATGGG + Intergenic
1133425142 16:5681823-5681845 TAATATACGGGAGTGGGGGAGGG + Intergenic
1133539138 16:6731788-6731810 TAGGAAACAGCAGTGGGGAAGGG - Intronic
1134305343 16:13027039-13027061 CCAGATACAGCAGTGGGGGAGGG - Intronic
1134352439 16:13450384-13450406 TAGCATAGATCAGTGGGAGATGG - Intergenic
1136670745 16:31854882-31854904 CAGATGACAGCAGTGGTGGATGG - Intergenic
1137424716 16:48368181-48368203 TAGAACACAGACGTGAGGGACGG + Intronic
1137651602 16:50125204-50125226 TAGAAGACAGCAGTCAGGGAAGG + Intergenic
1138097958 16:54228382-54228404 TAGAACACAACAGTGGGGGAAGG - Intergenic
1138153921 16:54685673-54685695 AAGAAGACAGCAGTGGTGCAGGG - Intergenic
1138212921 16:55178351-55178373 TAGGATATGGCAGTGGAGGAAGG - Intergenic
1138535656 16:57658934-57658956 TAGAATCCTGGAGTGGGGGTGGG + Intronic
1139559033 16:67730058-67730080 AAGAACACAGCAGTGAGCGAGGG + Intronic
1139898594 16:70308972-70308994 AAGAATACACTAATGGGGGAGGG - Intronic
1141239669 16:82254083-82254105 TACAAGACAGCAGTGGGGATTGG + Intergenic
1142381156 16:89732960-89732982 GCGAACACAGCAGAGGGGGAGGG - Intronic
1142735935 17:1899597-1899619 CAGGAAACAGAAGTGGGGGAGGG - Intronic
1143947459 17:10605624-10605646 TAGAGTACAGCAGAGGGTGCAGG - Intergenic
1145774394 17:27517755-27517777 TACAATACAGAAGTGGGCCAAGG - Intronic
1146265134 17:31447811-31447833 TAAAATACAGCAGTTGGGCGCGG - Intronic
1146668708 17:34722088-34722110 GAGAATACAGCAGGAGGGGAGGG + Intergenic
1148532672 17:48409714-48409736 TAGAGTTCAGGAGTGGGCGAGGG + Intronic
1149067570 17:52498314-52498336 TAGATTACAGAAGTAGGTGAGGG - Intergenic
1149073286 17:52569464-52569486 TTGAATAAATCAGTGGGGAATGG + Intergenic
1149208366 17:54275575-54275597 TAGAATGCAGCAGGGAGAGAAGG + Intergenic
1149414802 17:56448044-56448066 TAAAATAAATCTGTGGGGGAAGG + Intronic
1149419976 17:56500956-56500978 TACAAAACAGCAGTAGGGGTGGG + Intronic
1151224445 17:72638348-72638370 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1153400773 18:4682045-4682067 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1153540347 18:6147025-6147047 GAGAATGCAGCAGTGGAGCAAGG + Intronic
1155872937 18:31049673-31049695 TAGAATTCAGCAGAGGTGAAAGG - Intergenic
1156005643 18:32438091-32438113 AAGAATACAGAAATGGGGGAAGG - Intronic
1157820851 18:50767401-50767423 TAGATGCCAGCAGTGGGGGGTGG - Intergenic
1158018220 18:52809650-52809672 CGGCAAACAGCAGTGGGGGACGG + Intronic
1158094079 18:53750126-53750148 TAGAATACAGCAGAAGTGGCAGG + Intergenic
1158407982 18:57177497-57177519 TAGAATACAGCATTGGGGTGTGG - Intergenic
1158580908 18:58681951-58681973 TGGTCTACAGCAGTGGTGGAGGG + Intronic
1160340015 18:78081754-78081776 AAGAATACAGCAATGAGTGATGG - Intergenic
1161785833 19:6325048-6325070 CAGAAGTCAGCAGTGTGGGAGGG - Intronic
1163639361 19:18452636-18452658 TGGAGTAGAGCTGTGGGGGATGG - Intronic
1164173170 19:22745520-22745542 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1165221194 19:34317954-34317976 TAGCACAGAGCACTGGGGGAAGG + Intronic
925023807 2:592583-592605 CAGCAAACAGCAGTGGTGGAGGG - Intergenic
925503231 2:4530087-4530109 AAGAATTCAGGGGTGGGGGAAGG + Intergenic
926627387 2:15103533-15103555 TACAATATAGTAGTGGGGCAAGG - Intergenic
926887506 2:17611752-17611774 AAGAGTATAGCAGTGGGGCATGG - Intronic
927994351 2:27472652-27472674 TACAATACAGCAGTGAGACAAGG + Intronic
928348185 2:30519878-30519900 TGGCATTCAGCAGTGGTGGATGG - Intronic
928603987 2:32927304-32927326 GAGAAGACAGCAGTGAGAGATGG + Intergenic
928663196 2:33524781-33524803 TAGAATACTGTAGTGGTGGCCGG + Intronic
928731486 2:34237692-34237714 TCTGCTACAGCAGTGGGGGAAGG + Intergenic
929695741 2:44113754-44113776 TTGAATATGGCAGTGGTGGAAGG - Intergenic
930767350 2:55097548-55097570 AAGGAGACAGCAGTGGGGGAAGG + Intronic
933492139 2:82998988-82999010 TAGAGTACAGCAGTGGAAGGAGG - Intergenic
935748347 2:106209327-106209349 CAGCAAACAGCAGTGGTGGATGG - Intergenic
937219570 2:120334229-120334251 TAGAATACAGATGTGATGGATGG + Intergenic
937352286 2:121173635-121173657 TAGGATATGGCAGTGGGGGAAGG + Intergenic
938645375 2:133325124-133325146 TTGAATACGGCAGTGATGGAAGG - Intronic
938738984 2:134213327-134213349 TAAAAGGCAGCAGTGGGGGGCGG - Intronic
939674814 2:145059574-145059596 TTGAATTAAGCAGTGGAGGAAGG + Intergenic
940322908 2:152396131-152396153 TAAAATAAAGGAGAGGGGGAGGG - Intronic
940440368 2:153708105-153708127 TAGAATACAGAAATTGGTGACGG - Intergenic
940669037 2:156645140-156645162 TGGCAAACAGCAGTGGTGGATGG - Intergenic
940722290 2:157295153-157295175 TAGGAGACAGGAGTGGGGAATGG - Intronic
942679484 2:178462535-178462557 TGGCAAACAGCAGTGGTGGACGG - Intergenic
943187174 2:184625646-184625668 TAGTATAAAGCAGAGTGGGATGG + Intronic
944430285 2:199625909-199625931 AAGAATACAGGATTGGAGGAAGG + Intergenic
945626920 2:212220684-212220706 TTGAATATAGCAGGGAGGGAAGG - Intronic
946272456 2:218605682-218605704 TAATAGACAACAGTGGGGGAAGG + Intergenic
947047961 2:226009392-226009414 TAAAATCCTGCAGTGGGGGCCGG - Intergenic
947248064 2:228072066-228072088 TAGAATAAAAAAGTGGAGGAAGG + Intronic
947509489 2:230738219-230738241 TAGAATACAGCTGGGGAGAAAGG - Intronic
948533314 2:238627647-238627669 TAGAATAAAATAGTGGAGGAAGG + Intergenic
1168775673 20:445360-445382 GACAATACAGCAGGGTGGGAAGG + Intronic
1169886391 20:10403261-10403283 TAGAATACAGCAGAAGGGACAGG - Exonic
1170791114 20:19510377-19510399 CAGCACACAGCAGTGGGGCATGG - Intronic
1171416600 20:24985688-24985710 TGGAATAGAGCTGTGGGTGAAGG + Intronic
1172204457 20:33153038-33153060 GAGAAAGCAGGAGTGGGGGAAGG - Intergenic
1173721127 20:45259058-45259080 TAGATTCTAGCAATGGGGGAAGG + Intergenic
1177263980 21:18760153-18760175 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1177797093 21:25790276-25790298 TGGCATACAGCAGCGGGGGAAGG + Intergenic
1178420209 21:32437331-32437353 GAGACCACAGCAGTGGGGAAGGG - Intronic
1179259613 21:39746277-39746299 TGGCAAACAGCAGTGGTGGACGG + Exonic
1179913243 21:44461077-44461099 TGGGGTCCAGCAGTGGGGGATGG + Exonic
1181290286 22:21786904-21786926 TAGAATACAGCCATGGGGGTGGG + Intronic
1183237255 22:36628770-36628792 AAGAAAAAAGCAGTGGGGGTTGG - Intronic
1184285336 22:43467713-43467735 CAGAACACAGCAGAGGGGGATGG - Intronic
1185114418 22:48923451-48923473 GAGAACGCAGCAGTGGGGGAAGG - Intergenic
949315809 3:2753532-2753554 AAGGATACAGCAGTGGGAGAAGG + Intronic
949718180 3:6957692-6957714 GACAATAGAGCAGTAGGGGATGG - Intronic
949791005 3:7792033-7792055 TAGAATACTGCAGCCAGGGAAGG + Intergenic
949811676 3:8012972-8012994 CAGCAAACAGCAGTGGTGGATGG + Intergenic
950331006 3:12156151-12156173 AAAAGCACAGCAGTGGGGGAGGG - Intronic
951016256 3:17735811-17735833 CAGCAAACAGCAGTGGTGGATGG + Intronic
951326078 3:21303135-21303157 CGGAAAACAGCAGTGGTGGATGG + Intergenic
952071591 3:29643527-29643549 CAGAATGCAGCAGAGGAGGAAGG + Intronic
952294052 3:32045673-32045695 TAGAAGTAAGCTGTGGGGGAGGG + Intronic
952820698 3:37483472-37483494 TAGAAGACACCAGTGAGGCAGGG + Intronic
952978002 3:38712485-38712507 TAGAATCCAGCAGAGGGGGTGGG - Intronic
953700919 3:45195144-45195166 TAGAAGAGAGCAGTGGGGCAGGG - Intergenic
954619103 3:51985672-51985694 CAGGAGACAGCAATGGGGGATGG + Intronic
955381279 3:58440224-58440246 TGGCAAACAGCAGTGGTGGACGG + Intergenic
955908122 3:63829302-63829324 CACCATACAGCAGTGGGGTAAGG + Intronic
957000509 3:74877945-74877967 CAGCAAACAGCAGTGGTGGATGG + Intergenic
957687039 3:83515284-83515306 CAGCAAACAGCAGTGGTGGACGG - Intergenic
959160231 3:102715260-102715282 AAAAAAACAGCAGTGGGGGATGG - Intergenic
960288245 3:115853790-115853812 TAGGATAGAGCAGCTGGGGAGGG + Intronic
960621047 3:119637140-119637162 TAGAATATAAAAGTGGGGGTGGG - Intronic
960895172 3:122496697-122496719 AAAAAGACAGGAGTGGGGGAGGG - Intronic
961905772 3:130261469-130261491 TGGGATACAGCAATGGAGGATGG - Intergenic
962208245 3:133453596-133453618 TAGACTACAGGAGAGGGGAAAGG + Intronic
962710622 3:138082704-138082726 AAGGAGACAGCAGTGGGGAATGG - Intronic
963024086 3:140901144-140901166 TGGCAAACAGCAGTGGTGGATGG - Intergenic
964626369 3:158763938-158763960 GACAGTGCAGCAGTGGGGGAAGG - Intronic
964647007 3:158969205-158969227 CAGAATACAGAAGGGAGGGAAGG - Intronic
964999738 3:162938580-162938602 CAGATTACAGCAGTGTGGAATGG + Intergenic
965080989 3:164031691-164031713 TAGAAAACAGAAGTGAGGGCTGG + Intergenic
967290489 3:187915049-187915071 AAGTACAGAGCAGTGGGGGAAGG + Intergenic
968288378 3:197521277-197521299 TAGAATACAGCAGTGGGGGATGG - Intronic
969055118 4:4396839-4396861 TGGCATTCAGCAGTGGGGGTGGG + Intronic
969100753 4:4766401-4766423 TTGAATAGAGAAGCGGGGGAGGG + Intergenic
969502036 4:7559144-7559166 CAGAGTGCAGCAGTGGGTGATGG - Intronic
969882092 4:10183091-10183113 TAGGATACAGCAGTGGCAGAGGG + Intergenic
970402839 4:15734571-15734593 GAGAAAACAGGAATGGGGGAGGG + Intronic
971119870 4:23691202-23691224 GAGAACCCAGCACTGGGGGAAGG - Intergenic
973667238 4:53174721-53174743 TAGAGTCCTGGAGTGGGGGAAGG + Intronic
974487853 4:62526898-62526920 CAGCAAACAGCAGTGGTGGACGG + Intergenic
974841794 4:67307594-67307616 CAGAGAACAGCAGTGGTGGATGG - Intergenic
975418825 4:74138679-74138701 CAGCAAACAGCAGTGGTGGATGG + Intronic
976516566 4:85974452-85974474 TAGGATACATCATTTGGGGAGGG - Intronic
978587031 4:110284303-110284325 TGGCAAACAGCAGTGGTGGACGG + Intergenic
979910827 4:126363671-126363693 TGGCAAACAGCAGTGGTGGATGG - Intergenic
980190519 4:129519325-129519347 CAGCAAACAGCAGTGGTGGACGG - Intergenic
980523646 4:133961712-133961734 CAGCAAACAGCAGTGGTGGACGG - Intergenic
980868377 4:138580972-138580994 TAGAATAAAACATTGGGGGCTGG - Intergenic
981152490 4:141395586-141395608 TAGAATGCAGAAGTGGGGAAAGG - Intergenic
981292489 4:143092146-143092168 TAGAAAAAAACAGGGGGGGAGGG + Intergenic
982978783 4:162104067-162104089 TGGCAAACAGCAGTGGTGGACGG - Intronic
984897514 4:184554559-184554581 TAGAATAGAGGAGCGTGGGAAGG - Intergenic
986051435 5:4094103-4094125 CAGAATAGAGGGGTGGGGGAGGG + Intergenic
986223746 5:5793927-5793949 TGAAATGCACCAGTGGGGGAAGG + Intergenic
986887348 5:12256134-12256156 TGGAAAAAAGCAGTGGAGGAAGG - Intergenic
987100986 5:14591002-14591024 TAGAAAACAGAACTGGGGAAGGG + Intronic
987905347 5:24069366-24069388 TGGCAAACAGCAGTGGTGGACGG - Intronic
988983497 5:36595105-36595127 GAGTATAAAGCAGTGGAGGAAGG + Intergenic
989233459 5:39115461-39115483 TGGAAAACAGCAGTGGATGAGGG + Intronic
989688426 5:44114670-44114692 TGGCAAACAGCAGTGGTGGATGG - Intergenic
990249472 5:53898408-53898430 TAGAATTCAGCAGTGAAGCAAGG + Intronic
990891806 5:60658870-60658892 TGGTAAACAGCAGTGGTGGATGG - Intronic
993225633 5:85165289-85165311 TGGCAAACAGCAGTGGTGGACGG - Intergenic
993941859 5:94068393-94068415 TGGCAAACAGCAGTGGTGGATGG + Intronic
995229636 5:109744468-109744490 TAGACAGCAGCAGTTGGGGAGGG + Intronic
995465163 5:112444070-112444092 TGGCAAACAGCAGTGGTGGACGG - Intergenic
996019247 5:118573683-118573705 AGGAAAACGGCAGTGGGGGAAGG - Intergenic
997351302 5:133233331-133233353 CAGAATACAGGAGGGGGCGAGGG + Intronic
998806073 5:145918944-145918966 TACAATGCAGCATTTGGGGAGGG - Intergenic
999369227 5:151043136-151043158 TAAAATGCAGCAGTGGATGAAGG - Intronic
1000509634 5:162165223-162165245 TAGAATACAGGAGTGGGGGAGGG - Intergenic
1004236359 6:13878455-13878477 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1004398661 6:15268687-15268709 TACAAAACAGCAGGGGAGGATGG - Intronic
1006242884 6:32701401-32701423 TATTATACAGCAGTTGGAGATGG + Intergenic
1006410254 6:33869451-33869473 TTGATTAAAGCAGCGGGGGATGG + Intergenic
1007209337 6:40179606-40179628 AAGAATACAAGATTGGGGGAGGG - Intergenic
1007335996 6:41155625-41155647 GAGACTACAGCAGCTGGGGATGG + Intergenic
1008002665 6:46376872-46376894 CTTAATACAGCTGTGGGGGAGGG - Intronic
1008587985 6:52966297-52966319 TGGAATAAAGCAGTGGGGTCGGG + Intergenic
1009544321 6:65005109-65005131 TGGCAAACAGCAGTGGTGGACGG - Intronic
1011070165 6:83372755-83372777 TAGAGTAGACCAGTGGGAGATGG + Intronic
1011535981 6:88376549-88376571 TAGGATACAACAGTGTGTGATGG - Intergenic
1011595380 6:89011040-89011062 TAGAAAACAGAAGTGAGGTACGG - Intergenic
1012565137 6:100639723-100639745 CTGAATAGAGCAGTGGGGAAAGG - Intronic
1012734542 6:102921703-102921725 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1015321209 6:131877252-131877274 TAGAATTTAGGAGTGGGGGTAGG + Intronic
1015632764 6:135247944-135247966 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1016354185 6:143200406-143200428 GAGAATTCAGTAGTGGGGGTGGG - Intronic
1016444928 6:144121424-144121446 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1016605497 6:145918639-145918661 TAGAATACAGCAGACAGAGAAGG + Intronic
1017882818 6:158573390-158573412 CAGAAGCCAGCAGTGAGGGACGG - Intronic
1018022685 6:159776770-159776792 AGGATTACAGCAGTTGGGGAGGG - Intronic
1018575185 6:165252286-165252308 TAGAAAACAAGGGTGGGGGAGGG + Intergenic
1021832022 7:24623264-24623286 TAGAATTCAGCAGTGAAGGCTGG + Intronic
1022210681 7:28206047-28206069 TAGATGACAGGAGTGGAGGAAGG - Intergenic
1023052935 7:36268627-36268649 TGAAATACACCAGTGGAGGAAGG - Intronic
1024148021 7:46536784-46536806 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1026524683 7:71143742-71143764 TGGAATGCAGCAGTAGGGCAGGG + Intronic
1027981167 7:85224336-85224358 CAGAATACAGCACTGGGAGTTGG - Intergenic
1028589093 7:92477798-92477820 TGGCAAACAGCAGTGGTGGACGG + Intronic
1028796899 7:94912903-94912925 TAGAGTAGGGCAGTGGGGGTTGG - Intronic
1028941942 7:96531026-96531048 TAGAATTTAGCTATGGGGGAAGG + Intronic
1030336804 7:108337404-108337426 TGGCAAACAGCAGTGGTGGATGG - Intronic
1030843985 7:114386161-114386183 TGGCAAACAGCAGTGGTGGATGG + Intronic
1031556990 7:123189383-123189405 TAGAAGGCAGCAGTGGGAGAGGG - Intronic
1032143795 7:129359805-129359827 TAGAATCCAGGAGTGGAGTATGG - Intronic
1033414095 7:141147247-141147269 TAGAACACAGGAGGGAGGGAAGG - Intronic
1034112277 7:148548513-148548535 AAGAAAACAGAAGTGGAGGAAGG - Intergenic
1034417582 7:150973332-150973354 TAGAAAATAGCAGTTGGGAACGG - Intronic
1034707081 7:153155210-153155232 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1034776269 7:153829652-153829674 GAGAATACAGCTGTGAGGAAAGG + Intergenic
1035049987 7:155993183-155993205 TAGACTACAGCAGCGGCTGATGG - Intergenic
1035050001 7:155993273-155993295 TAGACTACAGCAGGGGCTGATGG - Intergenic
1035217592 7:157380420-157380442 TTGAATAGAACAGTGGGGGACGG + Intronic
1035421312 7:158731086-158731108 TAGAGAACAGCGGTGGGGGATGG - Exonic
1035530298 8:345829-345851 TAGAACACAGAGGTGGAGGAGGG + Intergenic
1035884985 8:3281884-3281906 ATGAAGACAGCACTGGGGGATGG - Intronic
1037744277 8:21630595-21630617 AAGAATACAGCAGAGAGGGAAGG + Intergenic
1038259519 8:25980828-25980850 TGGAGGAAAGCAGTGGGGGAGGG + Intronic
1039246163 8:35610804-35610826 TAGTATACATCAGTGGGGTATGG + Intronic
1040017650 8:42712842-42712864 AAAAAGAGAGCAGTGGGGGAAGG - Intronic
1040936507 8:52787558-52787580 TAGAATAAAGTTGGGGGGGAAGG - Intergenic
1040967640 8:53100518-53100540 CAGAGTTCAGCACTGGGGGAAGG + Intergenic
1042055652 8:64763075-64763097 TGGCAAACAGCAGTGGTGGACGG - Intronic
1042459693 8:69049176-69049198 CACAAGACAGCACTGGGGGATGG + Intergenic
1043181077 8:77087413-77087435 AAGAGAACAGCACTGGGGGATGG + Intergenic
1043603544 8:81971329-81971351 TGGCAAACAGCAGTGGGGGTGGG + Intergenic
1043817256 8:84816614-84816636 AAGAATACATCACTGGGGCAGGG + Intronic
1045041871 8:98232451-98232473 TAGAGTACAGTGGTGGGTGATGG + Intronic
1045561698 8:103270425-103270447 TAGAATATAGCAGAAGGTGAAGG - Intergenic
1045657587 8:104403114-104403136 TGGCAAACAGCAGTGGTGGACGG - Intronic
1045664320 8:104468926-104468948 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1046361540 8:113164944-113164966 TAGAATAAACCAATGGAGGAAGG - Intronic
1047276649 8:123410761-123410783 CAGCAAACAGCAGTGGTGGACGG - Intronic
1047925191 8:129675923-129675945 TTGAAAGCAGCAGTGGGGAACGG - Intergenic
1048358573 8:133674684-133674706 TAAAAGGAAGCAGTGGGGGAAGG - Intergenic
1048514518 8:135093752-135093774 TAGATTACAGAAGTTGGGGAGGG - Intergenic
1048973398 8:139657621-139657643 TACACTGCAGAAGTGGGGGATGG + Intronic
1050488861 9:6165873-6165895 GAGAGTACAGCAGATGGGGATGG - Intergenic
1051699196 9:19801422-19801444 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1052315377 9:27111436-27111458 TAGACTAAAGCAGTGGAGCAAGG + Intronic
1053134339 9:35640685-35640707 TGGCAAACAGCAGTGGTGGACGG + Intronic
1053176271 9:35927044-35927066 AAGAATAAAGCAGTGGGAGCTGG + Intergenic
1053625399 9:39865524-39865546 TAGAAGCCAGGAGTGGGGTAGGG - Intergenic
1054218490 9:62385165-62385187 TAGAAGCCAGGAGTGGGGTAGGG + Intergenic
1055352095 9:75400020-75400042 CACAAAACAGCACTGGGGGATGG + Intergenic
1056253379 9:84773390-84773412 AAGAACACAGCAGTGATGGAGGG + Intronic
1056527458 9:87456608-87456630 CACAAGACAGCACTGGGGGATGG + Intergenic
1057117150 9:92536196-92536218 TAGAAAACAGCAGTGGGTGTGGG + Intronic
1058543394 9:106035554-106035576 TAAAATACAGCAAAGGGGGTGGG - Intergenic
1058784640 9:108374978-108375000 CAGAATGCAGCAGTGGGGAGAGG - Intergenic
1058959021 9:109975374-109975396 TAGAACACAAAAGTGGAGGAAGG - Intronic
1059287723 9:113190488-113190510 TGGAATCCAGCTGTGGTGGAAGG + Exonic
1060706185 9:125803382-125803404 TAAAAGACATCAGTGGGGGCCGG - Intronic
1061676072 9:132216511-132216533 TAGGATTCTGCAGTGGGGCAGGG + Intronic
1062723892 9:138060394-138060416 TAGAAACCAGCAGAGGGGCATGG + Intronic
1187469735 X:19558590-19558612 TAAAATTCAGCAGTAGGGGTTGG - Intronic
1188186382 X:27120533-27120555 TAGAAAACAGGAATGAGGGAGGG - Intergenic
1189268476 X:39734080-39734102 AAGAATCCAGCAGAGGGTGAGGG - Intergenic
1189825854 X:44916571-44916593 AAGTATATAGCAGTGAGGGATGG - Intronic
1190251564 X:48730936-48730958 TAGAATTCAGGGCTGGGGGAAGG - Intergenic
1191048227 X:56162354-56162376 TAGACTACAGCACCGGGGCAGGG - Intergenic
1191868541 X:65725769-65725791 TAGAAAAGATCAGTGGGGGTGGG - Intronic
1191927130 X:66325704-66325726 GAGAATATGGCAGTGAGGGATGG - Intergenic
1192254874 X:69447982-69448004 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1192571972 X:72213538-72213560 TGGCAAACAGCAGTGGTGGACGG - Intronic
1192853931 X:74987161-74987183 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1192960997 X:76130737-76130759 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1193021248 X:76796218-76796240 TAGAAGACTGCAGTAGGAGATGG + Intergenic
1193172388 X:78350375-78350397 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1193306246 X:79956018-79956040 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1195146909 X:102027125-102027147 TGGGATCCAGCAGTGGTGGATGG - Intergenic
1195256572 X:103096771-103096793 TGCAATACAGCAGTGGTGAATGG - Intergenic
1195298973 X:103508515-103508537 TGGAACACAGCAGTAGGGGCTGG + Intronic
1197306557 X:124849314-124849336 TAGAATACAGCAAAGGTGGTGGG + Intronic
1199492072 X:148411232-148411254 GAGAATAGGGCAGTTGGGGAAGG - Intergenic
1200126917 X:153819537-153819559 TACTCTACAGCAGTGGGGTAAGG - Intronic
1200851945 Y:7892248-7892270 TAGCATTCAGTAGTGGTGGATGG + Intergenic
1201203950 Y:11565679-11565701 TAGAATGCAACAGTGTGGCATGG + Intergenic
1201204597 Y:11571276-11571298 TGGAATGCAGCAGTGTGGCATGG + Intergenic
1201205249 Y:11576888-11576910 TGGAATGCAGCAGTGTGGCATGG + Intergenic
1201205898 Y:11582494-11582516 TGGAATGCAGCAGTGTGGCATGG + Intergenic
1201206546 Y:11588101-11588123 TGGAATGCAGCAGTGTGGCATGG + Intergenic
1201724349 Y:17136736-17136758 TAGCATTCAGCAGTGGTGGATGG + Intergenic