ID: 968291025

View in Genome Browser
Species Human (GRCh38)
Location 3:197539955-197539977
Sequence GCTCACTGCCTAGACAGAAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 1, 2: 4, 3: 29, 4: 118}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968291025_968291028 -6 Left 968291025 3:197539955-197539977 CCGGTTCTGTCTAGGCAGTGAGC 0: 1
1: 1
2: 4
3: 29
4: 118
Right 968291028 3:197539972-197539994 GTGAGCAAGGTGAAGCCATTGGG 0: 1
1: 0
2: 61
3: 188
4: 519
968291025_968291027 -7 Left 968291025 3:197539955-197539977 CCGGTTCTGTCTAGGCAGTGAGC 0: 1
1: 1
2: 4
3: 29
4: 118
Right 968291027 3:197539971-197539993 AGTGAGCAAGGTGAAGCCATTGG 0: 1
1: 0
2: 63
3: 205
4: 632
968291025_968291030 12 Left 968291025 3:197539955-197539977 CCGGTTCTGTCTAGGCAGTGAGC 0: 1
1: 1
2: 4
3: 29
4: 118
Right 968291030 3:197539990-197540012 TTGGGCAGTTACATCCCTAGTGG 0: 1
1: 0
2: 0
3: 8
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968291025 Original CRISPR GCTCACTGCCTAGACAGAAC CGG (reversed) Intronic
901290878 1:8123410-8123432 GCCCGCTGCCTAGACAGAGCTGG + Intergenic
902709513 1:18229049-18229071 GCTCGCTGGCTGTACAGAACAGG + Intronic
906191281 1:43900987-43901009 GCCCACTGCCCACACAGACCAGG + Intronic
908562421 1:65319930-65319952 ACTCACTGACTAGAGAGAAGGGG - Intronic
908591324 1:65638596-65638618 GCTCACTTCATAGCCACAACTGG - Exonic
912188204 1:107306030-107306052 TCTCACAGCCTAGACTGAAGAGG - Intronic
919468770 1:197953114-197953136 GCCCACTGCCTAGACAGAGCCGG - Intergenic
920978932 1:210813710-210813732 ACTCACTGCCTGGGCAGAAATGG + Intronic
922861940 1:228826350-228826372 GCTCTTTGGCTAGAGAGAACAGG + Intergenic
924277598 1:242404108-242404130 GCTCACTGTCTAGAGAGGAGAGG + Intronic
1077523528 11:3050366-3050388 GCACACTCCCTAGCCAAAACTGG + Intronic
1078872592 11:15362921-15362943 GCTGACTGCCTAGAAAAAAAAGG + Intergenic
1079455276 11:20630979-20631001 GCTCACTGCAGAGTCAGAACTGG + Intronic
1079866045 11:25735479-25735501 ACTCACTGCCTAGACAGAATTGG - Intergenic
1081673098 11:44952612-44952634 CCTCACTGCCTTTACAGAGCTGG + Intergenic
1082045632 11:47724039-47724061 GCTGACTGGCTATAGAGAACTGG + Exonic
1082870508 11:57940371-57940393 GCTCTCTGACTAGATAGGACTGG - Intergenic
1084770422 11:71339514-71339536 GCTCCCTGCCTGGACAGAGTCGG - Intergenic
1085743170 11:79094145-79094167 GATCCCTGCCTAGAGAGCACAGG + Intronic
1087242019 11:95790496-95790518 GCTCACAGCTTACACAGAAAGGG - Exonic
1087820070 11:102701780-102701802 ACTCACTGCTCAGTCAGAACAGG - Intronic
1088747526 11:112816971-112816993 CCTCTCTTCCTAGAGAGAACTGG - Intergenic
1091038540 11:132255569-132255591 GCTCACTGCCCAGTCAGAGAAGG + Intronic
1091896435 12:4108991-4109013 GCTGCCTCCTTAGACAGAACGGG + Intergenic
1095329961 12:40948427-40948449 GCTTACTGTTTAGACAGAATTGG + Intronic
1096187112 12:49588478-49588500 GCCCGGTGCCTAGACAGAAAGGG + Exonic
1100248047 12:92784145-92784167 GAACACTGCTAAGACAGAACAGG + Intronic
1102164652 12:110796721-110796743 GCTCACTGCCTTCTCAGACCAGG - Intergenic
1108713928 13:53060308-53060330 GCCCACTGTCTAGACAGTAGGGG + Intergenic
1109310173 13:60684010-60684032 CCTCACTGCTTAGGCAGAAGGGG - Intergenic
1109610231 13:64755850-64755872 ACCCACTGCCTAGACTGAGCTGG + Intergenic
1112321915 13:98415639-98415661 CATCATTGCCTATACAGAACAGG + Intronic
1114422212 14:22593892-22593914 GCCCGCTGCCTAGACAGAGCTGG + Intergenic
1115891582 14:38035767-38035789 GCTCACTGGCTTTACAAAACAGG - Intronic
1117448704 14:55829759-55829781 GGTCAAAACCTAGACAGAACTGG + Intergenic
1118088275 14:62443309-62443331 GCCTGCTGCCTAGACAGAGCTGG - Intergenic
1122318316 14:100838580-100838602 GCTCACTGCCTAGTCAGTCAGGG - Intergenic
1129385153 15:75192280-75192302 GCACACTGACTAGACAGAGATGG + Intergenic
1131065095 15:89429577-89429599 GCCCACTCCCTGGACAGAAAAGG - Intergenic
1131953220 15:97704244-97704266 GCTCAGTCCCAAGACTGAACTGG - Intergenic
1132228612 15:100164735-100164757 GCTCATTGCAGAGAAAGAACGGG - Intronic
1132465129 16:73861-73883 GCTCCTTGGCTAGACAGAAAAGG + Intronic
1133945520 16:10344695-10344717 AACTACTGCCTAGACAGAACAGG + Intronic
1137240338 16:46650523-46650545 GCCCACTGTCTAGACAGAGCTGG + Intergenic
1140703083 16:77600938-77600960 GCTCAATGCCTAGGCAGAAAGGG + Intergenic
1141131701 16:81441904-81441926 GCTCAGTGCCTGGACAAAGCTGG - Intergenic
1141712568 16:85708460-85708482 GCTCTCTGATTAGACAGTACTGG + Intronic
1141730563 16:85820251-85820273 GGTCACTGACTTGACAGACCTGG + Intergenic
1146100578 17:29977544-29977566 GATCACTACCAAGGCAGAACTGG - Intronic
1146840468 17:36149594-36149616 GCTCTCTGCCAAGTCCGAACTGG + Intergenic
1147691596 17:42318906-42318928 GCTGACACCCTAGACAGAAAAGG + Intronic
1149477263 17:56973594-56973616 GCCCACTGCCTAGACAGAACCGG + Intergenic
1152206295 17:78976392-78976414 CTTCACTCCATAGACAGAACAGG + Intronic
1152263052 17:79277616-79277638 GCTCACTGCCTGGACAGGCAGGG + Intronic
1156469525 18:37368605-37368627 GCTCACTGCCAACACAGAGAAGG - Intronic
1156903287 18:42326181-42326203 GCCCACTGCCTAGACAGAGCTGG + Intergenic
1160318518 18:77869267-77869289 GCCCACTGCCTGGAAGGAACAGG + Intergenic
1161646042 19:5454041-5454063 GCTCATTGACAAGACAGTACTGG + Intergenic
1167181115 19:47904172-47904194 CTTCACTGCATAGACAGAACAGG + Intergenic
1167181783 19:47909532-47909554 CTTCACTGCATAGACAGAAGAGG + Intergenic
1167182433 19:47914922-47914944 CTTCACTGCATAGACAGAAGAGG + Intergenic
1167183100 19:47920274-47920296 CTTCACTGCATAGACAGAAGAGG + Intergenic
1167183768 19:47925624-47925646 CTTCACTGCATAGACAGAACAGG + Intergenic
1167184398 19:47930674-47930696 CTTCACTGCATAGACAGAAGAGG + Intergenic
1167185070 19:47936025-47936047 CTTCACTGCATAGACAGAACAGG + Intergenic
1167185722 19:47941414-47941436 CTTCACTGCATAGACAGAACAGG + Intergenic
1167186389 19:47946769-47946791 CTTCACTGCATAGACAGAACAGG + Intergenic
1167187040 19:47952160-47952182 CTTCACTGCATAGACAGAACAGG + Intergenic
1167187690 19:47957543-47957565 CTTCACTGCATAGACAGAACAGG + Intergenic
1167542151 19:50096089-50096111 CTTCACTGCATAGACAGAACAGG - Intergenic
1167542586 19:50099154-50099176 CTTCACTGCATAGACAGAACAGG - Intergenic
1167543023 19:50102219-50102241 CTTCACTGCATAGACAGAACAGG - Intergenic
1167543459 19:50105282-50105304 CTTCACTGCATAGACAGAACAGG - Intergenic
1167544132 19:50110626-50110648 CTTCACTGCATAGACAGAACAGG - Intergenic
1167544807 19:50115979-50116001 CTTCACTGCATAGACAGAACAGG - Intergenic
1167545482 19:50121331-50121353 CTTCACTGCATAGACAGAACAGG - Intergenic
1167546159 19:50126686-50126708 CTTCACTGCATAGACAGAACAGG - Intergenic
1167546836 19:50132021-50132043 CTTCACTGCATAGACAGAACAGG - Intergenic
1167547494 19:50137394-50137416 CTTCACTGCATAGACAGAACAGG - Intergenic
926366242 2:12135633-12135655 ACTCACTTCCTTCACAGAACTGG - Intergenic
927849887 2:26492281-26492303 GCTCACATCCTACACAGCACAGG + Intronic
931114571 2:59150695-59150717 GTTCACTGCTTAGAAAGTACTGG - Intergenic
932063073 2:68527681-68527703 TCTCACTGCCCAGACAGGGCAGG + Intronic
932699459 2:73983694-73983716 GCTAACAGCTTAGCCAGAACTGG - Intergenic
937153447 2:119701635-119701657 GCTGGCTGCCTAGACAGAGCCGG + Intergenic
937434519 2:121869492-121869514 GCTCACTGCAGAGAAAGGACAGG + Intergenic
937629862 2:124088981-124089003 GCCAACTTCCTAGAGAGAACAGG + Intronic
940014892 2:149093599-149093621 GTTCACTATCTGGACAGAACTGG + Intronic
942013698 2:171789950-171789972 GCTCACTGCCAAGACTGAGCAGG + Intronic
946597080 2:221317664-221317686 GGTCTCTACCTAGACAGAAAAGG + Intergenic
948570476 2:238914298-238914320 CCTCACTGCCCACACAGGACCGG + Intergenic
1172910014 20:38401649-38401671 GCTCTCTCCCTAGACAGATGGGG + Intergenic
1175309467 20:58001675-58001697 GCTCGCTGTCTAGACAGGGCTGG + Intergenic
1175601337 20:60276169-60276191 GATAACTTCCTGGACAGAACTGG + Intergenic
1176053022 20:63130508-63130530 CGTCACTGCCTAGACAGACGTGG + Intergenic
1176519871 21:7816266-7816288 GGGCACTGTCTAGACAGAGCAGG - Intergenic
1177936243 21:27349893-27349915 GCTCAATGCCTGAAGAGAACAGG + Intergenic
1178653899 21:34446279-34446301 GGGCACTGTCTAGACAGAGCAGG - Intergenic
1179008108 21:37531900-37531922 GGGCACTGCCAAGACAGAGCTGG + Intergenic
1181972531 22:26702826-26702848 GCACACTGCCTAGAGAAAGCTGG - Intergenic
950888237 3:16379389-16379411 GCTCAATGCCTAGACATAGTAGG - Intronic
951680864 3:25293266-25293288 GCTCACTGCCCAGACTGACACGG - Intronic
952182100 3:30928123-30928145 CCTCACTGCCCTGACAGAAGAGG + Intergenic
952823537 3:37505991-37506013 GGTCACTGCGTAGCCTGAACAGG - Exonic
954638478 3:52084514-52084536 CCTCGCAGCCTAGACAGGACCGG - Intronic
957278602 3:78121259-78121281 CCTCACTGCCTAGAGATAGCTGG - Intergenic
961311957 3:126007909-126007931 GCACACTGCCTAGACTGCAGCGG - Intronic
964183198 3:153912651-153912673 GCTTACTGGGTAGAGAGAACAGG + Intergenic
964407623 3:156365946-156365968 GCTCACTGTTTAGAAAGAATGGG + Intronic
964558839 3:157970675-157970697 GCTCACTCCAGAGAGAGAACAGG - Intergenic
964759773 3:160123789-160123811 GCCCACTACCTAGACAGAGCCGG + Intergenic
965313743 3:167164423-167164445 GCCCTCTGCCTAGCCACAACAGG - Intergenic
967338312 3:188369141-188369163 TCTCACTGCATAGACAGAAAAGG + Intronic
967708133 3:192676266-192676288 TCACACTTCCTAGACAGAACAGG + Intronic
968291025 3:197539955-197539977 GCTCACTGCCTAGACAGAACCGG - Intronic
977586401 4:98779801-98779823 GGTCACTGCCTTGACAGAGGTGG + Intergenic
981005848 4:139874548-139874570 GCACAATGCCTAGACACCACAGG + Intronic
982164087 4:152599325-152599347 CATCACTGGCTAGACAGAGCAGG + Intergenic
982904464 4:161050135-161050157 GCCCACTGCCTAGACAGAGCTGG - Intergenic
985817804 5:2139546-2139568 GGACACTGCCCAGACAGAAGTGG + Intergenic
988465501 5:31487413-31487435 GCCTACTGCCTACACATAACAGG + Intronic
990330394 5:54719790-54719812 GCTCACTGTCTAGAGGGGACTGG + Intergenic
991420015 5:66431207-66431229 GTCCTTTGCCTAGACAGAACAGG - Intergenic
998557858 5:143143198-143143220 GCTCACTGAATACACAGAGCTGG - Intronic
1004333567 6:14743385-14743407 TCTCACTGCCTAGGAAGTACTGG + Intergenic
1006122593 6:31816300-31816322 GCCTACGGCCTGGACAGAACGGG + Exonic
1006124456 6:31828494-31828516 GCCTACGGCCTGGACAGAACGGG + Exonic
1010112787 6:72260687-72260709 GCTCACTGCACAGACAGGATGGG - Exonic
1015320015 6:131862386-131862408 GCACACTTCCTAGACAGATTGGG + Intronic
1019173661 6:170148853-170148875 GCTCTCTGCCTGGAAAGAAGTGG - Intergenic
1019737540 7:2658163-2658185 GCACACGGCCGAGCCAGAACTGG + Intronic
1020905026 7:14053574-14053596 GCTCACTGACCAGGGAGAACTGG - Intergenic
1025188202 7:56877216-56877238 CCTCACTGCTTTGACAGAAGGGG - Intergenic
1025683721 7:63699704-63699726 CCTCACTGCTTTGACAGAAGGGG + Intergenic
1028154806 7:87418040-87418062 GCTCACTGCTTCCACACAACAGG - Intronic
1032781834 7:135170294-135170316 GCTCCCTGCCTGGGCAGAATGGG + Intronic
1034228860 7:149503484-149503506 GCTCACTGTCTAGTCAGAGATGG + Intergenic
1035182447 7:157099191-157099213 GCTCACTGTCAAGACACAAAAGG - Intergenic
1036180426 8:6579879-6579901 TCACACTGCCCACACAGAACTGG + Intronic
1037048878 8:14343403-14343425 TCTGACTGCCTTGACAGACCTGG - Intronic
1041206002 8:55498410-55498432 GCTCGGTGCCTGGACAGGACTGG - Intronic
1048275641 8:133063671-133063693 TCTGACTGGCAAGACAGAACGGG - Intronic
1058502739 9:105637798-105637820 GCTCCCTGCTTAGAGAGGACTGG - Exonic
1058902579 9:109455382-109455404 GCTCAGTGCCTAGATAGGGCTGG - Intronic
1059128757 9:111721853-111721875 GCTAACTGCCTTGAAAGAATTGG - Intronic
1059368044 9:113801841-113801863 GCTCACTACATAGACTGAGCAGG + Intergenic
1060306998 9:122422329-122422351 GTCCACTGCCTAGACAGAGCTGG + Intergenic
1186200752 X:7153088-7153110 TCTCACTGACTAGACATGACTGG + Intergenic
1188457241 X:30380384-30380406 GCTCACTTCCTAGATAAAATGGG - Intergenic
1189303517 X:39969799-39969821 GCTCCCAGCCTAGAGAGAAGGGG + Intergenic
1189348892 X:40262538-40262560 GCTCACTGTCAACACTGAACTGG - Intergenic
1191115214 X:56845144-56845166 GGTCACTGAATAGACAGAACTGG - Intergenic
1201720227 Y:17089136-17089158 ACTCACTGACTATACAGTACTGG + Intergenic