ID: 968291199

View in Genome Browser
Species Human (GRCh38)
Location 3:197541106-197541128
Sequence AGGGCTGCTTCTCAATTTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 151}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968291190_968291199 21 Left 968291190 3:197541062-197541084 CCCTCAATTTGCAGCTCTTACAG 0: 1
1: 0
2: 0
3: 10
4: 121
Right 968291199 3:197541106-197541128 AGGGCTGCTTCTCAATTTGAAGG 0: 1
1: 0
2: 1
3: 9
4: 151
968291189_968291199 27 Left 968291189 3:197541056-197541078 CCTCTTCCCTCAATTTGCAGCTC 0: 1
1: 0
2: 0
3: 21
4: 257
Right 968291199 3:197541106-197541128 AGGGCTGCTTCTCAATTTGAAGG 0: 1
1: 0
2: 1
3: 9
4: 151
968291191_968291199 20 Left 968291191 3:197541063-197541085 CCTCAATTTGCAGCTCTTACAGT 0: 1
1: 0
2: 0
3: 11
4: 129
Right 968291199 3:197541106-197541128 AGGGCTGCTTCTCAATTTGAAGG 0: 1
1: 0
2: 1
3: 9
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968291199 Original CRISPR AGGGCTGCTTCTCAATTTGA AGG Intronic
901717533 1:11168530-11168552 AGGGAGGCATCTGAATTTGAAGG - Intronic
901870023 1:12133063-12133085 TTGGCTGGTTTTCAATTTGAGGG + Intronic
903050082 1:20594166-20594188 AGGCCTGCTTTTGAATTGGATGG - Intronic
906180570 1:43814982-43815004 AGAGCTGGGTCTCACTTTGAAGG + Intronic
910514769 1:88047715-88047737 AGACCTGCATCTCAATCTGAGGG + Intergenic
911181321 1:94863081-94863103 AGGGCTGTTTCTAGTTTTGAGGG + Intronic
913684604 1:121220011-121220033 AGTGCTGCTTCTTATTTTCAAGG + Intronic
914036440 1:144007627-144007649 AGTGCTGCTTCTTATTTTCAAGG + Intergenic
914153014 1:145060319-145060341 AGTGCTGCTTCTTATTTTCAAGG - Intronic
915630863 1:157153492-157153514 AGGGATGGATTTCAATTTGAAGG - Intergenic
918001873 1:180504946-180504968 AGGCCAGCTTCTCAATGTTAAGG - Intergenic
918281846 1:183014351-183014373 GGGGTTGCTACTCAATTTCAAGG + Intergenic
920471916 1:206238561-206238583 AGTGCTGCTTCTTATTTTCAAGG + Intronic
921692837 1:218171965-218171987 AGGATTGCCTTTCAATTTGAAGG - Intergenic
922447570 1:225710422-225710444 AGGGCAGATTCACATTTTGAGGG - Intergenic
923564517 1:235066952-235066974 GGAGCTGCTTCTCTATTTGGAGG - Intergenic
923881797 1:238111597-238111619 AGGGCTGTTACTGAATTTGCAGG + Intergenic
924422044 1:243918611-243918633 AGCGCTGGTTCTCAGTTTGCTGG + Intergenic
1067601794 10:47611716-47611738 AAGGTTGCTTCTCAAATTTATGG + Intergenic
1071391775 10:85182519-85182541 ATGACTGCTTCTCAATGAGAGGG + Intergenic
1071653320 10:87419306-87419328 AAGGTTGCTTCTCAAATTTATGG + Intergenic
1072790653 10:98315397-98315419 AAGGCTGCTTCTCTCTTTGGGGG - Intergenic
1076086598 10:127637489-127637511 AGGGCTGCTGCACATTTTCAGGG - Intergenic
1076309442 10:129493774-129493796 AGGGCTGCTTCCCAGATTGAAGG - Intronic
1080521303 11:33070021-33070043 AGGGCTGGTTTTCAATCTGTCGG - Intronic
1080574224 11:33583608-33583630 AGGGCAGGTCCTCATTTTGAAGG + Intronic
1081781052 11:45713026-45713048 AGGCCTGCCTATCAATTTTAGGG + Intergenic
1084458899 11:69285373-69285395 TGGGCTCCTTCTCAATCTCAGGG + Intergenic
1085562995 11:77489213-77489235 AAGGCTGCTTCATTATTTGAAGG - Intergenic
1086295617 11:85364374-85364396 AGGGCTGCTTCTTAGTGGGAAGG - Intronic
1086993018 11:93326844-93326866 AGGGCTGCTTCTCCTCCTGATGG - Intergenic
1088768411 11:113008572-113008594 AGGACTGCTTCTCAAAATTATGG + Intronic
1091687727 12:2575419-2575441 GGGGCTGGGGCTCAATTTGACGG + Intronic
1093830862 12:23756021-23756043 ATGGATGCTTGTCAATTTCAGGG + Intronic
1094541085 12:31363775-31363797 AGGGCTCTTTCTCACTTGGATGG - Intergenic
1095491818 12:42743083-42743105 AAGTCTGCTTCCTAATTTGATGG + Intergenic
1096649949 12:53057602-53057624 AGGGCTGCTGTTCATTCTGATGG - Exonic
1097393222 12:59040977-59040999 AGAGCTGTTTCTGAATGTGATGG + Intergenic
1098074949 12:66719180-66719202 AGTTCTGTTTCTCAACTTGAAGG + Intronic
1098365888 12:69702839-69702861 ATAGCTGCTTCTCAAGTAGAAGG - Intergenic
1099957018 12:89360835-89360857 AGGGCTGCTTTTCATTTTGGAGG + Intergenic
1102045711 12:109828897-109828919 AGGGCTGATGTTCATTTTGATGG - Intronic
1108165447 13:47688331-47688353 AGGGCTGTCTGACAATTTGAGGG - Intergenic
1108711110 13:53033354-53033376 ATGGCTGGTTCCCATTTTGAAGG + Intronic
1109699476 13:66007127-66007149 CTAGCTGCTTCTAAATTTGATGG + Intergenic
1113693571 13:112328996-112329018 AGTCCTGCTTCTCAACTTGGGGG - Intergenic
1117453548 14:55875609-55875631 AGCACTGCTTCTAAATCTGAAGG - Intergenic
1117648761 14:57880337-57880359 AGGGCTTCTCCTCAACTTAAGGG + Intronic
1118193328 14:63601092-63601114 AGGGCTGCATTTCCATTTGGAGG - Intronic
1119988360 14:79166283-79166305 CCGGCTCCTTCTCAGTTTGAGGG + Intronic
1123691915 15:22845306-22845328 AAGGCTGCTTTATAATTTGAAGG + Intronic
1124324801 15:28749834-28749856 GGGACTGCTTAACAATTTGAGGG - Intergenic
1124528653 15:30482858-30482880 GGGACTGCTTAACAATTTGAGGG - Intergenic
1124770003 15:32524839-32524861 GGGACTGCTTAACAATTTGAGGG + Intergenic
1126242582 15:46462107-46462129 AGTGCTGCTTCTGCTTTTGAAGG + Intergenic
1126387679 15:48110652-48110674 AGGGATGCTTCAAAATTTGCTGG - Intergenic
1130318755 15:82821445-82821467 GGGACTGCTTAACAATTTGAGGG - Intronic
1131633313 15:94202961-94202983 AGGTCTGCATCTCAATTTGGGGG - Intergenic
1141303401 16:82838652-82838674 AGGGCTGCTTAAGAAGTTGATGG + Intronic
1144278437 17:13699648-13699670 AGGGCTTTTTCTCACTTTGTGGG + Intergenic
1148392308 17:47281341-47281363 AGGGCTCCTTACCAAGTTGAGGG - Intronic
1151243909 17:72779663-72779685 ATGGCAGCATCTCAAGTTGAAGG + Intronic
1156724434 18:40111059-40111081 AGAGCTGTGTCTCAATTTCAGGG + Intergenic
1157672656 18:49543325-49543347 AGGGCTGCTTTTCATATTTATGG + Intergenic
1158546968 18:58405109-58405131 AGGGCTTCTCCTCAATTTTGAGG - Intergenic
1161459628 19:4389098-4389120 AGGGCTCCTTCTCAGAGTGAGGG - Intronic
1164566946 19:29332736-29332758 AGGGCTCCTTCTCATCTTCAGGG - Intergenic
1166080149 19:40438995-40439017 AGGTCTGCATCCCAATATGATGG - Intergenic
1167133727 19:47604340-47604362 AGGGCTGCGTCTCACTTTGTGGG + Intergenic
1167814967 19:51871841-51871863 AGGGCTGCTTTTCTTTTTGGAGG - Exonic
1168005079 19:53480178-53480200 AGGGCTGATCTTCAATTGGAAGG + Intronic
925111192 2:1339591-1339613 AAGGCTTCCACTCAATTTGAGGG - Intronic
927286607 2:21363349-21363371 AGGGCTGCTTTTCTGTTAGAAGG + Intergenic
932959182 2:76391939-76391961 GAGGCTGCTTCTCTAATTGAAGG + Intergenic
933451607 2:82459897-82459919 AAGGCTGTGTCTCAATTTCAAGG - Intergenic
939909648 2:147963738-147963760 TGGGCTGGTTCTCAGTTTGGGGG - Intronic
940017562 2:149122734-149122756 AGGGCGGTTTCTCACTTTGGGGG + Intronic
940881476 2:158951358-158951380 AATGCTGCCTCTCAATTTGATGG + Intergenic
942304940 2:174598196-174598218 AGGGCTTCTTCTCATTTACAGGG + Intronic
943448959 2:188024193-188024215 AGGGCTACTTTTAAATTTGGGGG + Intergenic
945545483 2:211145100-211145122 AGGGCTGCTGCCCTATGTGATGG + Intergenic
947087586 2:226473087-226473109 TTGGCTGCTTCTTAATCTGAGGG - Intergenic
1170352643 20:15458943-15458965 AGGTCTGCTTGGCATTTTGAAGG + Intronic
1173577541 20:44122929-44122951 AGGGCATTTTCTCAGTTTGAAGG - Intronic
1174560821 20:51429436-51429458 AGTCCGGCTTCTCAATTTGGGGG - Intronic
1177890676 21:26800358-26800380 AGGGCTGCTCTGCAATCTGATGG - Intergenic
1179974602 21:44857288-44857310 AGGGCTGGGTCTCACTTTGTTGG - Intronic
1180716946 22:17878255-17878277 AGGGCTGCTTTCCTTTTTGAGGG + Intronic
1181507043 22:23366225-23366247 AGAGCTGCATCACAGTTTGAGGG + Intergenic
1183494301 22:38133671-38133693 TGGCCTACTTCTCAATGTGATGG - Intronic
1184565381 22:45288798-45288820 AGGGCAGCTTCTGATTCTGAAGG + Intronic
949888278 3:8713431-8713453 AGGGCTGCTTCTGTTGTTGATGG + Intronic
951552691 3:23890650-23890672 AGAGCTGCTTATGATTTTGAAGG + Exonic
952978184 3:38713965-38713987 CGGGCTCTTTCTCGATTTGAAGG - Exonic
956981207 3:74640834-74640856 ACTGCTGCTTCTCAATTCTATGG - Intergenic
957989555 3:87611858-87611880 AGGGCTGCTTCTCAAGAGCATGG - Intergenic
960581950 3:119288710-119288732 TGGGCTGTTTCTCAGGTTGAGGG + Intergenic
960628703 3:119706107-119706129 AAGGCTGCTTGTTAATTTAATGG + Intronic
962176409 3:133160163-133160185 AGGGCTGCTGCTCCTTTTGTGGG + Intronic
963321659 3:143815368-143815390 AAGGCAGCTTCTCCCTTTGATGG - Intronic
968291199 3:197541106-197541128 AGGGCTGCTTCTCAATTTGAAGG + Intronic
968536171 4:1131305-1131327 AGGGCTGATTCCCAAATTCAGGG + Intergenic
969881697 4:10179666-10179688 AGGGCTGCTTCTTGATTAGGAGG - Intergenic
969882999 4:10190975-10190997 AGGGCTGCTTCTTGATCAGAAGG - Intergenic
969904072 4:10376872-10376894 AAGCCTGCTTCTCAGTGTGAAGG - Intergenic
971004357 4:22357066-22357088 GGGGCTGCTTCTCTGCTTGAGGG - Intronic
972558523 4:40204708-40204730 AATGCTGCTTCTCCAATTGATGG + Intronic
975715641 4:77203293-77203315 AGGGCAGCTACTTAATTTGGTGG - Intronic
976597918 4:86911445-86911467 AGGGCTGCATCTTAATTTCATGG + Intronic
978149523 4:105416073-105416095 TGGAATGGTTCTCAATTTGAAGG + Intronic
981103014 4:140851188-140851210 AGGGCATCTTTTCCATTTGATGG + Intergenic
985128335 4:186717332-186717354 AAGGCTGCTGCTCAATTTCTAGG - Intronic
985178967 4:187235776-187235798 ATGCCTGTTTCTCAATTAGATGG - Intergenic
989364498 5:40640494-40640516 AGGGCTTCATATCAATTTGCAGG - Intergenic
992377656 5:76204529-76204551 AGGGCTGCTTGACAATTATATGG + Intronic
993873554 5:93279776-93279798 AGGACTGCTTCTCAGTATGGAGG - Intergenic
1001814370 5:174655638-174655660 ATGACTGCTTCCCCATTTGATGG - Intergenic
1003367881 6:5494273-5494295 AGGGCTGCTGCTTTCTTTGAAGG - Intronic
1005398724 6:25409914-25409936 AGCGGTGCTTCTCAAACTGAGGG - Intronic
1008862616 6:56168201-56168223 AGGGCTTGTTTTCAATTTGTTGG + Exonic
1009624306 6:66118778-66118800 CTGGCTGCTTCTCATTTTTAGGG + Intergenic
1012327886 6:97946174-97946196 ATGGCTGCTTCTCAATCTACTGG - Intergenic
1015917169 6:138228951-138228973 AGAACTGCTTCTCAATTTGTAGG - Intronic
1021249908 7:18311827-18311849 AGAGCTACTTTTCCATTTGAAGG + Intronic
1021792207 7:24217114-24217136 AGGCCTCCTTATCACTTTGAAGG + Intergenic
1022810265 7:33861409-33861431 AGGGTTGTTTCTCAAATTGGGGG + Intergenic
1023971544 7:44994880-44994902 AGGGCTGCTTCTCATTACGAGGG + Intergenic
1024517164 7:50268743-50268765 AGGGCTGCTACATAATTTGTAGG - Intergenic
1024879973 7:54074090-54074112 AGGGCTGCTTCCGAATAAGAAGG - Intergenic
1027825073 7:83102394-83102416 AGTGCTGCTTCTCATTTGAATGG + Intronic
1027994567 7:85409249-85409271 ATGGCTGGTTCTCATTCTGATGG + Intergenic
1029723981 7:102389945-102389967 AGGTCTAGATCTCAATTTGATGG + Intronic
1035082292 7:156226869-156226891 AGGGCTGCTGCTCACTTTTTTGG - Intergenic
1038052201 8:23824632-23824654 AGGGCTGATTCTCCATTGTAGGG + Intergenic
1038220983 8:25607575-25607597 AAGGCTGATTTTCAAATTGATGG - Intergenic
1039206643 8:35163023-35163045 TGAGCTGCTTCTCAAATTTACGG - Intergenic
1041328139 8:56691719-56691741 ATGTCTGTTTCTCAATATGATGG - Intergenic
1041367319 8:57121801-57121823 AGGGCTGCTCCTCAAGTTTGTGG - Intergenic
1041784675 8:61618127-61618149 AGGCCTACTTCTCAACTTGTGGG + Intronic
1047582163 8:126227943-126227965 AAGGCTCCTTCTCTATTTCATGG + Intergenic
1047797640 8:128274095-128274117 TGAGATGCTTCCCAATTTGAGGG + Intergenic
1049287525 8:141783842-141783864 AGGGGTGCTTCTAAGTGTGATGG + Intergenic
1051475095 9:17497348-17497370 AGAGATGCTTCTGGATTTGAAGG + Intronic
1052346620 9:27416393-27416415 ATGGCTGGTGCTTAATTTGATGG + Intronic
1054974141 9:71122327-71122349 AGGACAGTTTTTCAATTTGAAGG + Intronic
1059286444 9:113176545-113176567 AGGACTCCTTCTCAACTCGAAGG + Exonic
1060530095 9:124342939-124342961 AGGGCCGGTTCTCAAGTGGAGGG - Intronic
1061182251 9:129031585-129031607 AGGCATGCTTCCCAATTTGTGGG - Intergenic
1062342058 9:136098153-136098175 AGGGCTGCTTCTAAACCTGTTGG + Intergenic
1186738478 X:12492116-12492138 AGGGCTGCATCTAACTTTAATGG + Intronic
1186878219 X:13838402-13838424 AGGACTGCATCTCAATTTGAGGG + Intronic
1188231331 X:27667994-27668016 AGTGCTCCTTCTTAATGTGATGG + Intronic
1190183154 X:48211190-48211212 AGCCATTCTTCTCAATTTGATGG - Intronic
1190412194 X:50147837-50147859 ATAACTGCTTCTCAATTTGTTGG - Intergenic
1190526089 X:51331317-51331339 AGGGCTGCTTCACAATTGCCAGG - Intergenic
1190543381 X:51500353-51500375 AGGGCTGCTTCACAATTGCCAGG + Intergenic
1192572214 X:72215620-72215642 ACTGCTGCCTATCAATTTGAAGG + Intronic
1193061632 X:77213961-77213983 GGGGCTGATGCTCAATTTGTTGG - Intergenic
1195578704 X:106478118-106478140 ACTCCTGCTTCTCAATTTCATGG - Intergenic
1198936134 X:141904012-141904034 AGGGCTGCTTCTCTCTGTGGTGG - Intronic
1199636299 X:149815604-149815626 AGGTCTTATTCTCAATTTGGGGG - Intergenic
1201511124 Y:14764455-14764477 AGAGCTGCTTCTGAATTTGTAGG + Intronic