ID: 968291311

View in Genome Browser
Species Human (GRCh38)
Location 3:197541864-197541886
Sequence CCAGCTGTTCACAGGGATAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 171}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968291311 Original CRISPR CCAGCTGTTCACAGGGATAT TGG (reversed) Intronic
904896787 1:33823659-33823681 GCAGCTGTCCACAGGGAATTTGG + Intronic
908786880 1:67743817-67743839 CCAGCTTTTTACAAGGATATTGG + Intronic
909648886 1:77951297-77951319 TTAGCTTTCCACAGGGATATAGG - Intronic
909756503 1:79232102-79232124 GCAGCTGGTCAAAGGGAAATCGG - Intergenic
912545983 1:110452169-110452191 CCAGCTTTTTACATGGATAGTGG + Intronic
913555882 1:119966679-119966701 CCCGCTTTTCACAGTGACATGGG - Intronic
916537851 1:165721329-165721351 CAAGCTTTTCACAGGGAACTGGG + Intergenic
918359822 1:183745133-183745155 GCATCTGTTCACATGGATATTGG + Intronic
918563843 1:185902323-185902345 CCAGATTTTCATAGGGAGATGGG - Intronic
918954204 1:191183837-191183859 CCAGCTGTTGCCATGGAAATGGG - Intergenic
920289007 1:204903470-204903492 CCAGCTATAATCAGGGATATGGG - Intronic
920314871 1:205070101-205070123 CCACTTGTCCACAGGGATGTGGG + Intronic
921476418 1:215616008-215616030 CTAGCTGTTCACAGAAAGATAGG + Intronic
922724074 1:227914488-227914510 CCAGCTGTTGCCATGGATGTGGG + Intergenic
923180889 1:231518568-231518590 CCAGCTGTACAAAGAGCTATAGG - Intergenic
923190093 1:231611927-231611949 CCAGCTGGGCACAGGGAGCTGGG + Intronic
923793424 1:237130881-237130903 CCAGCTGTTCCCTGGCAGATGGG + Intronic
1062843295 10:687628-687650 CAAGGTGTTCACAGGGAATTCGG + Intronic
1062907753 10:1190297-1190319 CCAGAGGTTCACAGGAATTTTGG - Intronic
1063190046 10:3685051-3685073 CCTGCTGTTCACTGGGGCATTGG + Intergenic
1067152772 10:43750157-43750179 CCAGCTGATCACAGGGCTCCAGG + Intergenic
1068757703 10:60672887-60672909 CCAGTTGTTCACTGGAAAATTGG + Intronic
1069050359 10:63786032-63786054 CCAGCTGTTGCCAGTGATGTAGG - Intergenic
1074693571 10:116028354-116028376 CCTGCTGTCCACAGGGGGATCGG - Intergenic
1075070757 10:119318585-119318607 CCAGGTGATCACAGGGCTCTGGG + Intronic
1076628890 10:131841089-131841111 CCAGATGTCCACAGGGGTGTGGG + Intergenic
1076645154 10:131948694-131948716 CCTGCTGTTCACAGGGGCAGTGG - Intronic
1078809386 11:14743178-14743200 CCAGGTGGTCCCAGGGAGATGGG + Intronic
1078919598 11:15817234-15817256 CCAGCTGATCTCAGGGTTACTGG - Intergenic
1084648955 11:70476977-70476999 CCAGCTGTTCCCAGGTAGTTGGG + Intronic
1085464613 11:76715404-76715426 CAAGCAGTTCACAGGGTTAGGGG - Intergenic
1087017296 11:93566370-93566392 CCAGAGGTTCCAAGGGATATGGG + Intergenic
1091640322 12:2231092-2231114 GCAGGTGCTCACATGGATATGGG - Intronic
1092584889 12:9889164-9889186 CCAACTGTTCACATGAATTTAGG + Intronic
1093468658 12:19477708-19477730 GCATCTGTTATCAGGGATATTGG + Intronic
1093617765 12:21248818-21248840 CTTGCTGTTCACAGAGATGTGGG + Intergenic
1099548352 12:84012657-84012679 CCATGTATTCACAGGGATTTGGG + Intergenic
1101607605 12:106259403-106259425 CCAGGTATTCAAAGGGATCTGGG - Intronic
1101814393 12:108134522-108134544 CCAGCTGGTCACAAGCAGATCGG + Intronic
1102300775 12:111769468-111769490 CCACCTGTTCACAGTGCTCTTGG - Intronic
1102560060 12:113755536-113755558 CTGGCTGTCCACAGGGATAGGGG - Intergenic
1104068572 12:125326064-125326086 CACGCTGTTCACAGGGAGAGGGG + Intronic
1107210993 13:37853408-37853430 CCAGCTATTCACAGGGACTTGGG - Intronic
1108418914 13:50228831-50228853 CCTGCTGTTCAAAGGCAGATGGG + Intronic
1109414027 13:62011853-62011875 CCCTCTGTTCCCAGTGATATAGG - Intergenic
1110947091 13:81435709-81435731 CCAGATTTTCAGAGTGATATTGG + Intergenic
1111466506 13:88619355-88619377 CCAGGGTTTCACAGGGATATAGG - Intergenic
1112493133 13:99884793-99884815 CCAGCTGGTCTCAGGGATATGGG - Intronic
1114058166 14:18993395-18993417 CAAGCTGCTCACATTGATATTGG + Intronic
1114104381 14:19408359-19408381 CAAGCTGCTCACATTGATATTGG - Intronic
1114885064 14:26839124-26839146 CCTGGTGTTCACATGGATAGGGG - Intergenic
1118505081 14:66402429-66402451 CCAGATGTTCCCAGGGATAGTGG - Intergenic
1119145503 14:72310136-72310158 TCAGCAGTGCACAGGGCTATGGG - Intronic
1119832907 14:77719293-77719315 CCAGCTGAGCAAAGGGATCTAGG - Intronic
1121714962 14:96067258-96067280 ACATCAGTTCACAGGGAGATAGG + Intronic
1122065061 14:99167259-99167281 CCAGCTGTTCAAAGGCAGAATGG + Intergenic
1123497288 15:20840946-20840968 CAAGCTGCTCACATTGATATTGG - Intronic
1123590767 15:21851899-21851921 CAAGCTGCTCACATTGATATTGG - Intergenic
1126847893 15:52778575-52778597 CAAGCTGTTAGCAAGGATATGGG - Intronic
1128357216 15:66936515-66936537 ACAGCTGTTCCCAGGGAAATGGG - Intergenic
1128887789 15:71304226-71304248 CCAGCTGGTCACAGCCAGATGGG - Intronic
1129678265 15:77643850-77643872 ACAGCTGTAAACAGGGAAATGGG + Intronic
1132267791 15:100491491-100491513 CCATGTGTTGGCAGGGATATGGG - Intronic
1202962868 15_KI270727v1_random:141778-141800 CAAGCTGCTCACATTGATATTGG - Intergenic
1138953747 16:61945793-61945815 CAAGCTGTTTACAGGGAACTAGG + Intronic
1140678192 16:77355130-77355152 ACATCTGTTCAAAGAGATATGGG + Intronic
1140872750 16:79122048-79122070 CCAGCTGTGCACACGCATGTAGG + Intronic
1141116301 16:81312959-81312981 TCAGCTGCTCACAGGGATACTGG + Intergenic
1147544782 17:41392968-41392990 CCAGCTGTTCACAGTGCCAGGGG + Intronic
1148784872 17:50141067-50141089 CCAGCTGTTGCCAGGGAGCTGGG + Intronic
1151322896 17:73362041-73362063 CCTGCTGTTCTCAGGGAGAACGG + Intronic
1153143861 18:2006302-2006324 CCAAGTGTTTGCAGGGATATTGG + Intergenic
1154455310 18:14517354-14517376 CAAGCTGCTCACATTGATATTGG - Intronic
1159117035 18:64126532-64126554 GGAGCTGTTCACTGAGATATAGG + Intergenic
1160622779 18:80182192-80182214 CCAGTTGGTCACAGGCATTTTGG - Intronic
1164863227 19:31580459-31580481 CCAAGTGTTCACAGGGATGAGGG + Intergenic
1165342490 19:35222895-35222917 CCAGGTCTTTTCAGGGATATGGG + Intergenic
1166740074 19:45109313-45109335 CAAGCTGTTCACACTGAGATGGG - Intronic
924999163 2:391473-391495 CCTGGTGTTCTCAGTGATATGGG + Intergenic
926903382 2:17782634-17782656 CCAGAAGTTCACAGGTATATCGG + Exonic
926933414 2:18063007-18063029 CCAGCTGTTCACTGTGATAGGGG - Intronic
932597244 2:73101706-73101728 ACAGGTGTTCACAGGGGTGTTGG - Intronic
932860426 2:75285908-75285930 CCTGCTGTTGACTGGGATAATGG - Intergenic
937943964 2:127314140-127314162 TCAGCTGTTTGCAGGGATAAAGG - Intronic
938283045 2:130080844-130080866 CAAGCTGCTCACACTGATATTGG - Intronic
938356141 2:130651273-130651295 CAAGCTGCTCACACTGATATTGG + Intronic
938432565 2:131258055-131258077 CAAGCTGCTCACACTGATATTGG + Intronic
938476575 2:131620335-131620357 CAAGCTGCTCACATTGATATTGG + Intergenic
942026525 2:171916077-171916099 CCTGCTGTACATAGTGATATAGG + Intronic
942219638 2:173756619-173756641 CAAGCTGGTCACAGTGACATAGG + Intergenic
943351049 2:186796690-186796712 CCCAATGTTCATAGGGATATTGG - Intergenic
948319813 2:237060379-237060401 TCAGCTGTTGAGAGCGATATGGG - Intergenic
948768739 2:240236563-240236585 CCTGCTGTCCCCAGGGATCTGGG - Intergenic
948967585 2:241395534-241395556 CCAGGTGACCACAGGGATCTGGG - Intronic
948978873 2:241482430-241482452 CCAGCAGCTCACAGGGACCTCGG + Intronic
1170089801 20:12578206-12578228 CCAGCTGTTCTCAGCTAAATGGG - Intergenic
1171154015 20:22855100-22855122 ATCGATGTTCACAGGGATATGGG - Intergenic
1172009257 20:31836940-31836962 CCAGCTGTCCACAGGGGCAGTGG - Intergenic
1172277426 20:33687204-33687226 CCAGCTGATTACAGGGATTCCGG - Intergenic
1175595038 20:60224214-60224236 ACAGCTGTTCAAAGGGATGGAGG - Intergenic
1176042726 20:63073741-63073763 CCAAGTGTTCACAGGGCTCTTGG + Intergenic
1176818859 21:13635958-13635980 CAAGCTGCTCACATTGATATTGG + Intronic
1180083734 21:45498176-45498198 CCAGCTGTTCTCAGTGGTCTTGG - Intronic
1180476653 22:15716011-15716033 CAAGCTGCTCACATTGATATTGG + Intronic
1180598199 22:16993626-16993648 CCAGCTGTTCACAGCTGAATGGG - Intronic
1181599457 22:23940888-23940910 CCATGTGTTCACAAGGATTTGGG - Intergenic
1181609053 22:24000416-24000438 CCATGTGTTCACAAGGATTTGGG + Intergenic
1182773691 22:32815173-32815195 TGAACTGTGCACAGGGATATGGG + Intronic
1183695270 22:39418167-39418189 GCAGCTGTTCATGGGGATACTGG - Intronic
1183850393 22:40581475-40581497 CCAATTGTTAACAAGGATATGGG - Intronic
949923343 3:9021727-9021749 CCAGTTGTTAAAAGGGATTTGGG - Intronic
950457277 3:13100183-13100205 TCAGCTGTGCACAGGGAGTTGGG + Intergenic
950570005 3:13793884-13793906 CCAGGTGTGCACAGGGAGAGAGG - Intergenic
953627950 3:44586192-44586214 GCTGCTGTGCACAGGAATATGGG + Exonic
954648078 3:52143593-52143615 CCAGCTGGACCCAGGGATCTGGG - Intronic
955039017 3:55296883-55296905 CCACCTCTTCACAGGGCTGTAGG + Intergenic
956273657 3:67474829-67474851 CCAGCTTTCCACAGGCGTATGGG + Intronic
957178402 3:76843426-76843448 CTATCTGTTGACAGGAATATAGG + Intronic
958632171 3:96699062-96699084 CCAGGTGTTCAAAGGGACTTGGG + Intergenic
959733165 3:109627592-109627614 CCATTTGTTCACATGGCTATTGG + Intergenic
960653417 3:119977381-119977403 CCTGCTGTTCTCAGTCATATAGG - Intronic
960971924 3:123145941-123145963 TCAGTTGTTCCCTGGGATATGGG + Intronic
962038641 3:131682288-131682310 CCAGGTATTCAAAGGGATTTGGG + Intronic
962328892 3:134460221-134460243 CCAGCTGCACACAGGCATTTTGG + Intergenic
963382716 3:144552298-144552320 CCAGCTGATCGCAGAGCTATAGG + Intergenic
965177548 3:165355219-165355241 CCAGCTGTTGAAAGTGCTATTGG - Intergenic
967674654 3:192282214-192282236 CCAGATGTTCACCTAGATATTGG - Intronic
968291311 3:197541864-197541886 CCAGCTGTTCACAGGGATATTGG - Intronic
968827156 4:2907431-2907453 CCTGCTGGTCCCAGGGTTATGGG + Intronic
969592162 4:8128060-8128082 CCTGCTCTTCACAGGGGTATAGG + Intronic
971273716 4:25175393-25175415 CCGGCTGTTGACTGGGATGTTGG - Intronic
978961869 4:114689467-114689489 CCTGCTTTTGACAGGGATACAGG - Intergenic
978976378 4:114879809-114879831 CCAGCTGTTTTCAGGGTTTTAGG - Intronic
981436097 4:144723730-144723752 TCAGCTATTAACAGGGATACAGG + Intronic
990498382 5:56371155-56371177 CCATCTGTTCACAGACATTTGGG + Intergenic
992704141 5:79370889-79370911 CCTGCTGTTCCCATGGTTATTGG - Intergenic
993407332 5:87527760-87527782 CAAGCTCTTAACAGTGATATGGG - Intergenic
993441978 5:87968305-87968327 CCATCTGTTGAAAGGGGTATTGG - Intergenic
995012380 5:107271882-107271904 AAAGCAGTTCACAGGGACATTGG - Intergenic
999848797 5:155515165-155515187 GGAACTGTTCACAGGGATAGAGG + Intergenic
1001113302 5:168916977-168916999 CCAGCTGTTCAGAAGGAGAGAGG - Intronic
1005655977 6:27937875-27937897 CCAGCTGTCCACAGAGACGTGGG - Intergenic
1008125240 6:47660597-47660619 CCACCACTTCTCAGGGATATGGG - Intronic
1009408829 6:63341586-63341608 CCACCTGTTCCCTGGGATATAGG + Intergenic
1011221531 6:85059339-85059361 GCAGGATTTCACAGGGATATCGG + Intergenic
1011625193 6:89277805-89277827 CCAGGTGTTGGCAAGGATATGGG + Intronic
1014692564 6:124579092-124579114 CCAGGTATTCATAGGGATTTGGG - Intronic
1019511939 7:1422046-1422068 CCAGGTGTGCACAGGTAAATAGG + Intergenic
1019630466 7:2046239-2046261 CCAGCTGAGGACAGGGACATAGG - Intronic
1023938680 7:44756779-44756801 GCAGCTGTCCACAGGGAGGTTGG - Intronic
1024179093 7:46870928-46870950 CCAGCTGTGGTCAGGGAGATAGG - Intergenic
1024833332 7:53487294-53487316 ACAGATGTTGACATGGATATGGG - Intergenic
1026602504 7:71788321-71788343 CCAGCTGATCACAGAGGTGTAGG - Intronic
1028451224 7:90985733-90985755 ACAGCGACTCACAGGGATATAGG - Intronic
1029981600 7:104884602-104884624 CCAGCTGTTAGGAGGGAAATTGG + Intronic
1030077042 7:105745808-105745830 CCATCTGTTCCCAGGGCTCTAGG + Intronic
1031645720 7:124222539-124222561 GCACCTGTTCACAGGGAAACAGG - Intergenic
1032186889 7:129734528-129734550 CCAGCTGTTCCGAGGGCTGTAGG + Intronic
1032297137 7:130649621-130649643 CCATCTGTTCACAATGATTTAGG + Intronic
1034541284 7:151759780-151759802 CCAGCTGTTCTCAGGGCCAAGGG + Intronic
1037643963 8:20773482-20773504 CCAGCTGTGCACATGGACACAGG - Intergenic
1037743932 8:21628614-21628636 CCAACTGATCACAGGCATCTTGG + Intergenic
1038153281 8:24961706-24961728 CAGGCAGGTCACAGGGATATTGG + Intergenic
1040085498 8:43336014-43336036 CAAGCTGCTCACATTGATATTGG + Intergenic
1047413238 8:124641278-124641300 CAAGTTGCTCACAGGTATATGGG - Intronic
1047901228 8:129424010-129424032 CCAGGTCTTCAAAGGGATTTGGG - Intergenic
1049285263 8:141771473-141771495 CCAGATGTTCTCAGGGAAAGAGG - Intergenic
1050142240 9:2528049-2528071 CCAAGTGTTAACAGGGATGTGGG - Intergenic
1050508371 9:6370085-6370107 CCAGGTGTTCAAAGGGACTTGGG - Intergenic
1050723914 9:8624331-8624353 ACAGCTTTTCACAAGGAAATAGG - Intronic
1051720579 9:20032935-20032957 CCAGCTGTAAAAAGGGAAATCGG - Intergenic
1051892074 9:21952678-21952700 CTTGTTTTTCACAGGGATATGGG + Intronic
1051992203 9:23164409-23164431 TCAGCTATTCAGAGGGATTTGGG - Intergenic
1057773720 9:97988236-97988258 CAGGTTGTTCACAGGGATTTTGG + Intronic
1061094661 9:128448691-128448713 CCAGCTGCTCATTTGGATATAGG + Intergenic
1203528498 Un_GL000213v1:113547-113569 CAAGCTGCTCACATTGATATTGG - Intergenic
1187603051 X:20853630-20853652 CCATTTGTTCGCAGGGATAGCGG + Intergenic
1188814531 X:34695059-34695081 ATTGGTGTTCACAGGGATATTGG + Intergenic
1189605390 X:42672334-42672356 CCAGCTGTTAAGAGTGCTATGGG + Intergenic
1190602565 X:52107827-52107849 CCAGGTATTCAAAGGGATTTAGG + Intergenic
1191258747 X:58291346-58291368 CCAGGCTTTCACAGGGATTTTGG + Intergenic
1192080899 X:68046914-68046936 CCAGCTCTTCACAGTGTTATAGG + Exonic
1196269947 X:113698836-113698858 CCAGGTATTCAAAGGGATTTGGG + Intergenic
1196576475 X:117324904-117324926 CCAGGTATTCAAAGGGCTATAGG + Intergenic
1198329110 X:135605269-135605291 CCAGCTGTTCACAGGTATCGAGG + Intergenic
1198337432 X:135680307-135680329 CCAGCTGTTCACAGGTATGGGGG - Intergenic
1198361754 X:135902501-135902523 CCAGCTGTTCACAGGTATGGGGG + Intronic
1199845418 X:151689273-151689295 CCAGGTATTCAAAGGGATTTGGG - Intergenic