ID: 968292541

View in Genome Browser
Species Human (GRCh38)
Location 3:197549749-197549771
Sequence CAAGTAGAACATGTTTAGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 135}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968292541_968292547 25 Left 968292541 3:197549749-197549771 CCTACCTAAACATGTTCTACTTG 0: 1
1: 0
2: 0
3: 7
4: 135
Right 968292547 3:197549797-197549819 TTTTAAAAAGCAGTGTAACTAGG 0: 1
1: 0
2: 9
3: 55
4: 546
968292541_968292544 -9 Left 968292541 3:197549749-197549771 CCTACCTAAACATGTTCTACTTG 0: 1
1: 0
2: 0
3: 7
4: 135
Right 968292544 3:197549763-197549785 TTCTACTTGGCTGATTTGTTTGG 0: 1
1: 0
2: 0
3: 18
4: 195

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968292541 Original CRISPR CAAGTAGAACATGTTTAGGT AGG (reversed) Intronic
900890009 1:5442764-5442786 CCAGGAGAACTTGTTTAGCTTGG + Intergenic
902195955 1:14798287-14798309 AAAGTAGAACATAATTAAGTAGG + Intronic
905575446 1:39040524-39040546 GAAGTAGAAAATGTTAAAGTGGG + Intergenic
906896235 1:49775642-49775664 CAAGGAGCACATATTTAGGTGGG - Intronic
908802647 1:67896528-67896550 GAAACAGAACATGGTTAGGTGGG - Intergenic
908986976 1:70036195-70036217 CTAGCAGAACAAGTTTGGGTGGG - Exonic
909891946 1:81018207-81018229 CAAGGAGAGCATGTCTAAGTTGG - Intergenic
913096108 1:115516980-115517002 TAAGTAGAAAATTTTTAAGTAGG + Intergenic
917224244 1:172764661-172764683 CATGTAGATCCTGTTTATGTAGG + Intergenic
918697375 1:187560707-187560729 CAGGTAGAATCTGTTTAAGTCGG - Intergenic
1069375245 10:67786751-67786773 AAAGTAGAACCTGATTGGGTTGG - Intergenic
1078442092 11:11376731-11376753 CGAGTAGAAGATGGCTAGGTTGG - Intronic
1080494577 11:32804104-32804126 CAAGAATACCAGGTTTAGGTTGG - Intergenic
1080766014 11:35297362-35297384 CAAGTACAACATGGGTAAGTGGG - Intronic
1083367310 11:62149006-62149028 AAAGTAGAATTTGTTGAGGTGGG + Intronic
1088003092 11:104906480-104906502 CAAGTAGAAGATGATAGGGTGGG - Intergenic
1088006555 11:104948118-104948140 CAAGTAGAAAATGATAGGGTGGG - Intronic
1088275750 11:108083492-108083514 AAAGTAGAACATTTCTAGGCTGG + Intronic
1092694810 12:11159371-11159393 CAAGTAGAAAATGCTTAGGCAGG + Intronic
1093249150 12:16778868-16778890 TAAATAGAAGATGTTTATGTAGG - Intergenic
1093455943 12:19365020-19365042 CAAGTAGCACTTCATTAGGTGGG - Intronic
1093556655 12:20483798-20483820 GAAGTAAAACATGTTGAGATTGG - Intronic
1095308699 12:40669101-40669123 CAAATAGAATCTGTTTTGGTTGG + Intergenic
1096737797 12:53669475-53669497 CAAGTAGAACCTTTTAACGTAGG + Intronic
1097949770 12:65414832-65414854 CAGGTAGAATAAGTTCAGGTGGG + Intronic
1102703078 12:114856779-114856801 CAGGTAGCACATGTTTGGGTTGG - Intergenic
1107342240 13:39420291-39420313 CAATTTGAACCTCTTTAGGTAGG + Intronic
1110373340 13:74764225-74764247 CAAGAAGAACATCTTCTGGTAGG + Intergenic
1111972700 13:94933639-94933661 AAACTATAACATGTGTAGGTAGG + Intergenic
1119926481 14:78499204-78499226 CAACTAGATCATGTTTATGAAGG + Intronic
1123799755 15:23807727-23807749 CATGTTGAACATGTTGAGATGGG + Intergenic
1126563242 15:50067769-50067791 TAGGCAGAATATGTTTAGGTGGG - Intronic
1127305627 15:57703086-57703108 CAAGAAGAACACATTTAGGATGG + Intronic
1127508862 15:59620737-59620759 AAAGTGGAACATGTTTTTGTAGG + Exonic
1127754227 15:62075241-62075263 TAAGTAGAACAATTTTAAGTCGG - Intergenic
1130237406 15:82148598-82148620 CAAGTGGAACAAGTTGAAGTGGG + Intronic
1133635025 16:7657055-7657077 CAGGAAGAACAGATTTAGGTTGG - Intronic
1134088579 16:11375932-11375954 CATGGAGAACATGTTGAGGCTGG + Intronic
1134235939 16:12466628-12466650 CAGGTAGATCATGGTGAGGTAGG - Intronic
1136988504 16:35136861-35136883 CAAGTAATACATGTTTAAGGTGG + Intergenic
1139748766 16:69095737-69095759 CAAGTAGGACATATTTTGGCAGG + Intergenic
1140313127 16:73868041-73868063 CAAGAAGACCAGGTTTAGGGAGG - Intergenic
1146262041 17:31428141-31428163 CAAGGAGAAGATGGTTAGGGTGG + Intronic
1147692274 17:42323646-42323668 CAAGTAGTACATTTTCAGCTTGG + Intronic
1151053644 17:71007292-71007314 CAATGAGAACATGTGAAGGTTGG - Intergenic
1154277347 18:12973804-12973826 AAAGTGGAAAATATTTAGGTAGG - Intronic
1155484385 18:26326245-26326267 AAATTAGAAAATATTTAGGTGGG + Intronic
1156940022 18:42755943-42755965 CAAGTAGTAATTATTTAGGTTGG + Intronic
1158377961 18:56893963-56893985 CAAGTAGAATAGGTTTAGATGGG - Intronic
928434796 2:31247987-31248009 GAAGTAGTGGATGTTTAGGTTGG + Intronic
931317067 2:61142865-61142887 CAATTAGAAAATGTTTAAATTGG - Intergenic
931933792 2:67172048-67172070 CAAATTTAACATGTTTAGGTAGG + Intergenic
937420324 2:121748995-121749017 CAAAGAAAAAATGTTTAGGTTGG + Intronic
944756120 2:202763801-202763823 CAAGTAGACAATGATTAGGTGGG - Intronic
946846082 2:223860097-223860119 AAAATAGAAAATGTTTATGTGGG - Intronic
1170230405 20:14040562-14040584 CAAGTATACCATATTTGGGTGGG - Intronic
1170425721 20:16233638-16233660 CAAATAGTTAATGTTTAGGTAGG - Intergenic
1172543360 20:35739629-35739651 GAAGTAGGAAATGTTTAGGCTGG - Intronic
1177082803 21:16661926-16661948 CAGGGAGTACATGTGTAGGTTGG - Intergenic
1177256493 21:18669743-18669765 CAAGTAGGACAGGTTAAGTTTGG - Intergenic
951505752 3:23443354-23443376 CAAGGAGAATATGGTTTGGTAGG + Intronic
957670597 3:83296273-83296295 CAAGGAGTACATGTGCAGGTGGG + Intergenic
961514296 3:127423121-127423143 CAGGTAGAACATGGTTAGCGTGG + Intergenic
962108709 3:132419165-132419187 GAAGTAGAACATATTAAGGGAGG + Intronic
963580061 3:147114764-147114786 CAAGGAGCTTATGTTTAGGTGGG + Intergenic
963769451 3:149375242-149375264 CATTTAGAATTTGTTTAGGTCGG + Intronic
964092795 3:152895771-152895793 CAAGTACAAAATGTTTAAGAGGG + Intergenic
964227563 3:154425417-154425439 AAGGTAGCACATGCTTAGGTGGG - Intronic
968292541 3:197549749-197549771 CAAGTAGAACATGTTTAGGTAGG - Intronic
970244346 4:14043471-14043493 CAAGTAGAACAAACTCAGGTAGG - Intergenic
970478598 4:16450590-16450612 CAAATTGGACATATTTAGGTTGG + Intergenic
973140454 4:46761155-46761177 CAATTAGAGCATTTTTAAGTGGG + Intronic
973746204 4:53965689-53965711 CAAGTAGGAGATGCTCAGGTGGG + Intronic
975438683 4:74384596-74384618 AAAGTTGAACAGATTTAGGTTGG - Intronic
977861169 4:101961897-101961919 ACATTAGAAAATGTTTAGGTAGG + Intronic
978145826 4:105370204-105370226 CAAGTATGACATGTTTAGAAAGG - Intronic
982080208 4:151782301-151782323 CAAGGAGAACATATTTAACTTGG + Intergenic
982951988 4:161710315-161710337 CAAGTAAAAGATGATTAGTTAGG + Intronic
983470963 4:168153598-168153620 CAAATAAAACATGATTAGTTAGG - Intronic
986355805 5:6924663-6924685 CATGTAGTCCATGTTTTGGTAGG + Intergenic
987386570 5:17335452-17335474 CAGGGAGAACAGATTTAGGTTGG + Intergenic
989744950 5:44818006-44818028 TACATAAAACATGTTTAGGTAGG + Intronic
990769352 5:59224980-59225002 CAAGTAAAACAATTTTTGGTTGG - Intronic
994816386 5:104592663-104592685 CAAGTTGGACATGGTTTGGTGGG - Intergenic
995116082 5:108481326-108481348 TAAGTGGAACCTGTTTATGTTGG - Intergenic
996947305 5:129085863-129085885 AAAGTAGATGATGGTTAGGTCGG - Intergenic
998880118 5:146636921-146636943 CAAGTAGGATTTGGTTAGGTGGG - Intronic
1000808198 5:165824246-165824268 AAAGTAGAACATGCTTAGCAAGG - Intergenic
1004105638 6:12665233-12665255 AAAATAGAAACTGTTTAGGTGGG + Intergenic
1004935059 6:20499372-20499394 CAAAGAGAACATGTTTAAATGGG + Intergenic
1005436008 6:25813030-25813052 AAACTGGAACATGTTTAGTTTGG + Intronic
1006193935 6:32225991-32226013 CTATTATAGCATGTTTAGGTGGG + Intergenic
1008346738 6:50436817-50436839 CGTGTAGAACAGGTTTAGATAGG + Intergenic
1012656562 6:101830424-101830446 CATGTAGAACTTCTTTAAGTAGG - Intronic
1014516394 6:122384129-122384151 TAAGAAGAACTTGTTTAGGGTGG + Intergenic
1018410947 6:163547818-163547840 CAAGTAGAAAATGGATAGGAGGG - Intronic
1020044644 7:5031898-5031920 GAAGTAGAAGATGTTTTGTTTGG + Intronic
1020075041 7:5252339-5252361 AAATTAGAAAATGTTCAGGTCGG + Intergenic
1020896406 7:13945548-13945570 TAAGTCGAAGATTTTTAGGTTGG - Intronic
1021184334 7:17545602-17545624 AAAGTAGAACATATTTATTTTGG - Intergenic
1026725015 7:72864268-72864290 GAAGTAGAAGATGTTTTGTTTGG + Intergenic
1026747149 7:73022464-73022486 GAAGTAGAAGATGTTTTGTTTGG + Intergenic
1026750799 7:73050607-73050629 GAAGTAGAAGATGTTTTGTTTGG + Intergenic
1026754448 7:73078717-73078739 GAAGTAGAAGATGTTTTGTTTGG + Intergenic
1026758100 7:73106750-73106772 GAAGTAGAAGATGTTTTGTTTGG + Intergenic
1027033253 7:74907035-74907057 GAAGTAGAAGATGTTTTGTTTGG + Intergenic
1027089305 7:75286734-75286756 GAAGTAGAAGATGTTTTGTTTGG - Intergenic
1027092948 7:75314662-75314684 GAAGTAGAAGATGTTTTGTTTGG - Intergenic
1027096591 7:75342629-75342651 GAAGTAGAAGATGTTTTGTTTGG - Intergenic
1027272969 7:76534059-76534081 GAAGTAGAAGATGTTTTGTTTGG + Intergenic
1027322756 7:77025051-77025073 GAAGTAGAAGATGTTTTGTTTGG + Intergenic
1027326418 7:77053143-77053165 GAAGTAGAAGATGTTTTGTTTGG + Intergenic
1027669076 7:81073711-81073733 CAAGAAAAACATGTTTTGGCAGG - Intergenic
1030130308 7:106194089-106194111 CAAGAAGCAGATGTTAAGGTGGG + Intergenic
1030691491 7:112539516-112539538 AAAGAAGAACAGGTTTGGGTGGG - Intergenic
1031368861 7:120938783-120938805 CAAGAGAAACAAGTTTAGGTTGG - Intergenic
1031518397 7:122730819-122730841 GAAGTAGTATATGTTTATGTTGG - Intronic
1031750106 7:125561612-125561634 AAAGGAGAACTTGTTTTGGTGGG + Intergenic
1032033192 7:128501590-128501612 CAACAAGTTCATGTTTAGGTAGG - Intronic
1032202948 7:129836134-129836156 AAAGTAGCCCATGATTAGGTAGG + Intronic
1032457243 7:132082639-132082661 CAAGGAGAACATAATTAGGAAGG - Intergenic
1033325734 7:140376714-140376736 CGAGCAGAACACGTTTATGTGGG + Intronic
1034593779 7:152168016-152168038 AAAGTAGAAAATGTTTTGCTTGG - Intronic
1035845979 8:2864794-2864816 CAATTAGAAAATGTGTGGGTAGG + Intergenic
1037331700 8:17749360-17749382 CAATTAGAAAATCTTTAGGCTGG + Intronic
1039221770 8:35339642-35339664 GGAGTAGAACATGTCTAGATTGG + Intronic
1041355209 8:56993226-56993248 CAGGTAGAACATCTTGCGGTTGG + Exonic
1043031525 8:75139507-75139529 CAACTGAAAGATGTTTAGGTTGG + Intergenic
1044463084 8:92470193-92470215 CAAGTAGAACACGTCTTGGGTGG - Intergenic
1046475871 8:114742253-114742275 CATGGAGAACATGTTTTTGTCGG - Intergenic
1050729675 9:8694510-8694532 TAAGAAAAATATGTTTAGGTAGG + Intronic
1050918635 9:11169145-11169167 CTAGTAAAACATGTTTATGGAGG + Intergenic
1051761043 9:20464829-20464851 CAAGTAGGAAATGTTTAGGAAGG - Intronic
1052430136 9:28355556-28355578 CAAGGAGAACAAGTGAAGGTGGG + Intronic
1055528342 9:77157759-77157781 TAAGTAGTACGTGTTTAGTTTGG - Intergenic
1056005589 9:82267420-82267442 CAAGTGGAACAAGTTCAGTTTGG - Intergenic
1056818126 9:89816473-89816495 CAAATAGAACATGGTGAGGGCGG - Intergenic
1057027482 9:91745962-91745984 TAAGTTGAACTTGATTAGGTTGG + Intronic
1057323810 9:94040945-94040967 GAAGGAGAACTTGTTCAGGTAGG - Intronic
1059877740 9:118654532-118654554 GAAGTAGAAAATGTTTAGTGAGG + Intergenic
1189172868 X:38926248-38926270 CAGTTGGAGCATGTTTAGGTTGG + Intergenic
1195134625 X:101892263-101892285 GAAGTAGAAAATGTATAGGGTGG + Intronic
1198692166 X:139296181-139296203 AAAGTAGAACATATTGAGGGTGG + Intergenic