ID: 968292659

View in Genome Browser
Species Human (GRCh38)
Location 3:197550690-197550712
Sequence GCCGATCTGCAGGGGGTGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 444
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 414}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968292645_968292659 12 Left 968292645 3:197550655-197550677 CCACTGGGCCCTGAAGCCACAGA 0: 1
1: 0
2: 2
3: 31
4: 411
Right 968292659 3:197550690-197550712 GCCGATCTGCAGGGGGTGGGGGG 0: 1
1: 0
2: 1
3: 28
4: 414
968292650_968292659 -4 Left 968292650 3:197550671-197550693 CCACAGAGAGAGGGAGAAAGCCG 0: 1
1: 0
2: 2
3: 35
4: 422
Right 968292659 3:197550690-197550712 GCCGATCTGCAGGGGGTGGGGGG 0: 1
1: 0
2: 1
3: 28
4: 414
968292648_968292659 4 Left 968292648 3:197550663-197550685 CCCTGAAGCCACAGAGAGAGGGA 0: 1
1: 0
2: 3
3: 51
4: 428
Right 968292659 3:197550690-197550712 GCCGATCTGCAGGGGGTGGGGGG 0: 1
1: 0
2: 1
3: 28
4: 414
968292649_968292659 3 Left 968292649 3:197550664-197550686 CCTGAAGCCACAGAGAGAGGGAG 0: 1
1: 0
2: 5
3: 77
4: 628
Right 968292659 3:197550690-197550712 GCCGATCTGCAGGGGGTGGGGGG 0: 1
1: 0
2: 1
3: 28
4: 414

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968292659 Original CRISPR GCCGATCTGCAGGGGGTGGG GGG Intronic
900169030 1:1257396-1257418 GCCGAGCTGAGGGGGGGGGGGGG - Intronic
900259716 1:1719987-1720009 GAGGACCTGCAGGGGGTGAGGGG + Intronic
900402687 1:2479053-2479075 GGCTCTGTGCAGGGGGTGGGTGG + Intronic
900942713 1:5811401-5811423 GCTGATGGGCGGGGGGTGGGGGG - Intergenic
901722033 1:11206758-11206780 GGCGATCAGCAGTGGGTGGATGG - Intronic
901936405 1:12630123-12630145 GCAGATATGCAGGGGTTGGGGGG - Intergenic
902235741 1:15056255-15056277 GCCGGTCCGCAGGGTGAGGGGGG - Exonic
902370891 1:16006166-16006188 GCCGCTCTGCAGAGGGTCTGTGG + Exonic
903667474 1:25016918-25016940 GCCGCTCTGCACGGGTGGGGCGG - Intergenic
903809107 1:26024688-26024710 GCTGAGCTGCAGGGGCTTGGGGG - Intronic
904319142 1:29685185-29685207 TCTGATCAGCAGGAGGTGGGGGG + Intergenic
904836729 1:33342520-33342542 CCTGAACTGCATGGGGTGGGGGG - Intronic
906055862 1:42916464-42916486 GCCAATCAGCAGGATGTGGGTGG - Intergenic
906676097 1:47694596-47694618 GCCGATCTGCCACGGATGGGAGG - Intergenic
907052931 1:51342014-51342036 GCAGATCTGCTGTGGGAGGGAGG - Intronic
911854066 1:102854548-102854570 ACCGATCAGCAGGATGTGGGTGG + Intergenic
912387804 1:109281022-109281044 ACGGATCTGATGGGGGTGGGTGG + Exonic
913165530 1:116181311-116181333 GCAGACCTGCATGGGGAGGGCGG - Intergenic
914914612 1:151811429-151811451 GCCGATCTGGAGGAGGGGGTGGG + Exonic
915540939 1:156565766-156565788 CCCATTATGCAGGGGGTGGGAGG - Intronic
916034592 1:160910367-160910389 ACCAATCAGCAGGAGGTGGGTGG - Intergenic
917522263 1:175757923-175757945 GCCGAGCTGCAGGATGGGGGTGG + Intergenic
917543701 1:175940181-175940203 GCCGAACAGCAGGAGGTGAGTGG - Intergenic
918942855 1:191025330-191025352 GCCAATCAGCAGGATGTGGGTGG - Intergenic
919112889 1:193242093-193242115 GCAGGTTTGCAGGGGTTGGGGGG + Intronic
919808867 1:201396942-201396964 GCCTGTCTGCAGGGGGTGAGGGG - Intronic
919859685 1:201731338-201731360 GCCGATGTGCAGGGGGTGTGCGG + Intronic
919991916 1:202713334-202713356 GGGTATGTGCAGGGGGTGGGAGG - Intergenic
921354780 1:214275722-214275744 ACCGATCAGCAGGATGTGGGCGG - Intergenic
921442847 1:215208345-215208367 GCCTACCTGAAGGGGGAGGGTGG + Intronic
922001742 1:221485710-221485732 GCCAACCTGTAGGGGGTGAGTGG + Intergenic
922855921 1:228774470-228774492 GCCAATCAGCAGGATGTGGGTGG + Intergenic
924072107 1:240291358-240291380 GTAGACCTGCAGGGGGTGGGTGG + Intronic
1063095749 10:2907470-2907492 GCAGATCTGCAGAGGGGAGGGGG - Intergenic
1063416289 10:5875101-5875123 GCCAGACTGCGGGGGGTGGGAGG + Intronic
1063432098 10:5999699-5999721 GCGGGTCTGCAGGGGATCGGTGG + Intergenic
1063848843 10:10161829-10161851 GCCAATCAGCAGGATGTGGGTGG + Intergenic
1064317340 10:14270495-14270517 GGCTCTCTGCAGAGGGTGGGAGG - Intronic
1065590495 10:27257448-27257470 ACCAATCTGCAGGATGTGGGTGG + Intergenic
1065896007 10:30163578-30163600 ACCGATCAGCAGGATGTGGGTGG + Intergenic
1067448419 10:46367033-46367055 GACCATGTGGAGGGGGTGGGGGG + Intergenic
1067588956 10:47493733-47493755 GACCATGTGGAGGGGGTGGGGGG - Intergenic
1067636082 10:48001824-48001846 GACCATGTGGAGGGGGTGGGGGG - Intergenic
1068240254 10:54295338-54295360 GCCAATCAGCAGGATGTGGGCGG + Intronic
1069683452 10:70301224-70301246 GCCGAGCAGCACGTGGTGGGTGG - Exonic
1070123926 10:73604961-73604983 ACCGATCAGCAGGACGTGGGTGG - Intronic
1070132641 10:73665831-73665853 GACCATGTGGAGGGGGTGGGGGG - Intergenic
1070607071 10:77906249-77906271 GCCTATCAGCAGTGGGTGTGGGG - Intronic
1075690061 10:124388655-124388677 GAAGTTGTGCAGGGGGTGGGAGG - Intergenic
1076769016 10:132652984-132653006 GCCGATGTGCAGGTGGGCGGAGG + Intronic
1077191835 11:1258925-1258947 ACCAACCTGCAAGGGGTGGGAGG - Exonic
1077499562 11:2903032-2903054 GCCCACCTGCAGGGGTCGGGGGG + Intronic
1077602571 11:3583685-3583707 GGCTCTCAGCAGGGGGTGGGAGG - Intergenic
1077701483 11:4445986-4446008 GCCTATCTGAAGGTGGAGGGTGG + Intergenic
1078045133 11:7906671-7906693 GCAGCTCTGCTGGGGGTGCGGGG + Intergenic
1078223889 11:9374688-9374710 TCAAGTCTGCAGGGGGTGGGGGG - Intergenic
1081106728 11:39079210-39079232 ACCAATCTGCAGGATGTGGGTGG + Intergenic
1081125209 11:39312875-39312897 ACCAATCAGCAGGGTGTGGGTGG + Intergenic
1081575652 11:44317203-44317225 ACCGATCTGCAAAGGGTGGACGG - Intergenic
1082008907 11:47437565-47437587 GCTGACGTGCAGTGGGTGGGAGG - Intergenic
1082106857 11:48229938-48229960 GCCAATCAGCAGGATGTGGGTGG + Intergenic
1084640603 11:70423702-70423724 GCCTAGCTGCAGAGGGAGGGTGG + Intronic
1084701062 11:70786313-70786335 GCAGATGGGCAGGGGCTGGGTGG + Intronic
1085127928 11:74014482-74014504 GCAGAACTGCAGGGGGTAGGTGG - Intronic
1088517648 11:110656146-110656168 GACTATGTGGAGGGGGTGGGAGG + Intronic
1090366845 11:126213414-126213436 GTAAATTTGCAGGGGGTGGGTGG - Intronic
1090586057 11:128214601-128214623 GCCAATCAGCAGGATGTGGGTGG - Intergenic
1091591782 12:1846745-1846767 GGCGACCTGCAGGGGTTTGGGGG + Intronic
1091675292 12:2484704-2484726 GGGCATCTGCTGGGGGTGGGGGG - Intronic
1092205654 12:6613145-6613167 GCAGCTCTGCAGGGAGGGGGCGG - Intergenic
1096622591 12:52874024-52874046 GTGGCTCTGCGGGGGGTGGGAGG - Intergenic
1099189405 12:79547307-79547329 GGCGGGGTGCAGGGGGTGGGAGG - Intergenic
1099204487 12:79711770-79711792 GCCAATCAGCAGGATGTGGGTGG + Intergenic
1099518618 12:83630374-83630396 GCCTAACTGCAGGGGGTCAGAGG + Intergenic
1099933419 12:89099108-89099130 GTGGAACTGCAGGGGGTGGGGGG + Intergenic
1101610052 12:106283096-106283118 GCAAAACTGCAGGGAGTGGGGGG - Intronic
1101705571 12:107217549-107217571 ACCGATCAGCAGGACGTGGGTGG + Intergenic
1103560085 12:121789036-121789058 GCCCATCTGCAGAGGCTGGATGG - Intronic
1103595274 12:122021596-122021618 GCCGGTCTGCGGGGCGCGGGGGG - Exonic
1103861260 12:124016109-124016131 GCCCTTCTGATGGGGGTGGGGGG + Intronic
1103865104 12:124045315-124045337 CCCGATCTGCATGGCGTTGGAGG + Intronic
1103954502 12:124568623-124568645 GCAAACCTGGAGGGGGTGGGAGG - Intergenic
1104198885 12:126567975-126567997 GCCAATCAGCAGGATGTGGGTGG + Intergenic
1104329035 12:127826842-127826864 GCCAATCAGCAGGATGTGGGTGG - Intergenic
1104374009 12:128248081-128248103 GCCAATCAGCAGGATGTGGGTGG + Intergenic
1104754480 12:131260485-131260507 GCAGATGTGCTGGGGCTGGGAGG + Intergenic
1104899042 12:132178337-132178359 GCTGGAGTGCAGGGGGTGGGGGG - Intergenic
1104934027 12:132355082-132355104 GCCCACCTGCATGGGGTGGAAGG + Intergenic
1105506006 13:21010313-21010335 TCAGATCTGCAGGGTGTGTGGGG - Intronic
1105669832 13:22600803-22600825 GCCGCACAGCAGGAGGTGGGTGG - Intergenic
1105762116 13:23524877-23524899 GCCAATCAGCAGGATGTGGGTGG + Intergenic
1105763239 13:23532375-23532397 GCCAATCAGCAGGAAGTGGGTGG + Intergenic
1105777524 13:23677470-23677492 ACCAATCAGCAGGGTGTGGGTGG - Intergenic
1107478483 13:40764154-40764176 TCATATCTGCAGGGGTTGGGGGG + Intronic
1107869000 13:44729883-44729905 GCAGGTGTGCAGGGGGTGGTTGG + Intergenic
1109416309 13:62045909-62045931 GCCAATCAGCAGGATGTGGGTGG - Intergenic
1110260262 13:73476890-73476912 GCGGATCTTCATGGCGTGGGTGG - Intergenic
1112330885 13:98476244-98476266 CCCACTCTGCAGGGGGCGGGGGG - Intronic
1113113397 13:106848645-106848667 GCCTTTCTGCAGAGGGTGGGGGG - Intergenic
1113371829 13:109732201-109732223 GCCAATCAGCAGGATGTGGGTGG - Intergenic
1113506767 13:110822042-110822064 GCCAATCAGCAGGATGTGGGTGG + Intergenic
1114492751 14:23113593-23113615 GTCTGTCTGCGGGGGGTGGGGGG + Intergenic
1114762352 14:25330257-25330279 GCCTTTCTGCTGGGGGTAGGGGG - Intergenic
1115533132 14:34345390-34345412 ACCGATCAGCAGGATGTGGGTGG - Intronic
1117082749 14:52167996-52168018 GCCAATCAGCAGGATGTGGGTGG + Intergenic
1119195529 14:72714475-72714497 GCGGCTCTGCAGGGGGCAGGAGG - Exonic
1119303575 14:73590152-73590174 GCCAATCAGCAGGATGTGGGTGG - Intergenic
1119850114 14:77861096-77861118 GCTAATCGGCAGGGGGTGGAGGG - Intronic
1120169830 14:81237072-81237094 GCCAATCAGCAGGATGTGGGTGG + Intergenic
1120871268 14:89339443-89339465 GCCAACCTGCAGGAGCTGGGAGG + Intronic
1121287841 14:92750323-92750345 GCCAATCAGCAGGATGTGGGTGG + Intergenic
1122745288 14:103894148-103894170 GCCCGTGTGGAGGGGGTGGGGGG + Intergenic
1122790640 14:104182849-104182871 GCTCACCTGCAGGGGATGGGTGG + Intergenic
1122828526 14:104383954-104383976 GAGGGTCTGCAGGGGGAGGGTGG - Intergenic
1122971797 14:105155216-105155238 GCCCATGGGGAGGGGGTGGGCGG - Intronic
1123806742 15:23881504-23881526 ACCAATCAGCAGGGTGTGGGCGG - Intergenic
1125565620 15:40676453-40676475 ACCAATCAGCAGGGTGTGGGTGG - Intergenic
1126429825 15:48570843-48570865 GCCAGGCTGCAGGGGATGGGTGG + Intronic
1128509355 15:68303880-68303902 CACGATCTGCAAGGGGAGGGGGG + Exonic
1128735663 15:70052519-70052541 GAAGATCTGCAGGTGGTGGGAGG + Exonic
1129461113 15:75700482-75700504 GCCCTTCTGCAGGGGCTGGCGGG + Intronic
1131071681 15:89470137-89470159 GCGGCTCTGCTGGGGGAGGGAGG + Intergenic
1132598860 16:765098-765120 GCCTCTCTGCAGGGTGTGCGGGG + Exonic
1132877902 16:2148505-2148527 CCCGCTCGGCGGGGGGTGGGGGG - Intronic
1133023693 16:2978195-2978217 GCCAATTTTCAGGGGGTTGGTGG - Intronic
1133324663 16:4935764-4935786 GCCGGACTGCAGGGGTTGAGTGG + Intronic
1133863267 16:9616879-9616901 GCAGATTTGGAGGAGGTGGGAGG + Intergenic
1134047019 16:11108493-11108515 GGCTAGCTGCAGAGGGTGGGTGG - Intronic
1134443108 16:14310997-14311019 GGCAGGCTGCAGGGGGTGGGTGG - Intergenic
1136356738 16:29748951-29748973 GCCAATCAGCAGGATGTGGGTGG + Intergenic
1136556743 16:31011410-31011432 GCCCCATTGCAGGGGGTGGGAGG - Intergenic
1138889750 16:61128274-61128296 GCCAATCAGCAGGATGTGGGTGG - Intergenic
1141619374 16:85228708-85228730 GCAGATCTGCCGTGGCTGGGTGG + Intergenic
1141694742 16:85614053-85614075 GCCGCTCCGCCGGGGGTGGGGGG - Intronic
1141704367 16:85656587-85656609 GCCGAGCTGCATGGGCTGCGTGG + Exonic
1142064223 16:88051309-88051331 GGCGGCCTGCAGGGTGTGGGTGG + Intronic
1142326502 16:89418920-89418942 CCAGATCAGCCGGGGGTGGGTGG - Intronic
1142715621 17:1745446-1745468 GCCCATCGGCAGGGGTCGGGGGG + Intronic
1142851984 17:2708779-2708801 GCCCCTCGGGAGGGGGTGGGTGG - Intronic
1143907962 17:10224963-10224985 GCAGATGTGCAGAGGGTGGGCGG - Intergenic
1146373469 17:32279702-32279724 GCTTATGTGCACGGGGTGGGTGG + Intronic
1147742395 17:42676603-42676625 GCCGAGCAGTAGGGGGTCGGAGG + Exonic
1148053392 17:44779970-44779992 GCTGAGCCGCAGGAGGTGGGTGG - Exonic
1148075384 17:44932630-44932652 GCTGAGCTGCAGGGTGGGGGCGG + Intronic
1148332404 17:46820306-46820328 GCTGGACTGGAGGGGGTGGGAGG + Intronic
1148864953 17:50623636-50623658 GCAGTTTTGCAGGGGGTGGGGGG + Intronic
1151360631 17:73586591-73586613 GGTGGACTGCAGGGGGTGGGTGG + Intronic
1151729846 17:75904775-75904797 GCAGCTCTGCGGGGGGGGGGGGG - Intronic
1151840526 17:76614461-76614483 GCCAATCAGCAGGATGTGGGTGG - Intergenic
1151983121 17:77526127-77526149 GCCCACCAGGAGGGGGTGGGGGG + Intergenic
1152296069 17:79467613-79467635 GCCTAACTGCAGATGGTGGGGGG + Intronic
1152362414 17:79838926-79838948 GCCGAGCTGCTGGGGGGGTGGGG - Intronic
1155003447 18:21707369-21707391 GCCAATCAGCAGGATGTGGGTGG + Intronic
1155190010 18:23421498-23421520 GCAGATCTGCTGGGGCTGGATGG - Intronic
1155560720 18:27073388-27073410 GCCCAGCTGATGGGGGTGGGGGG + Intronic
1155824266 18:30419532-30419554 ACCAATCAGCAGGAGGTGGGTGG + Intergenic
1155872239 18:31042721-31042743 GCCGAGGTGCAGGGCGCGGGAGG + Exonic
1157342491 18:46791786-46791808 GAGGTTCTGCAGGGGTTGGGAGG - Intergenic
1159109945 18:64043991-64044013 GCCAATCAGCAGGATGTGGGTGG + Intergenic
1159167829 18:64725233-64725255 ACCAATCAGCAGGAGGTGGGTGG - Intergenic
1159878504 18:73835462-73835484 GCAGTCCTGCAGGGGTTGGGGGG - Intergenic
1160506081 18:79427520-79427542 GCCTCTGTGCAGTGGGTGGGGGG + Intronic
1160506143 18:79427733-79427755 GCCTCTGTGCAGTGGGTGGGGGG + Intronic
1160913996 19:1488087-1488109 GCTGTTCTGCAGGGGGAGGCGGG + Exonic
1160940977 19:1620356-1620378 GCTTATCCGCAGGGGGTCGGGGG - Intronic
1161087237 19:2340797-2340819 GCCACTCTGCAGGGGGTGCCTGG + Intronic
1161484214 19:4525980-4526002 GCAGATGTGGAGGGGGTGGGTGG - Intronic
1162360516 19:10217294-10217316 CCCCATCTGTAGGGGCTGGGAGG + Intronic
1162561308 19:11419391-11419413 GCCGAGCTGCTGGGGCGGGGCGG + Intergenic
1164310600 19:24042319-24042341 ACCAATCTGCAGGATGTGGGTGG + Intronic
1164401503 19:27905259-27905281 GCCTGTCTGCAGGAGGTGAGAGG - Intergenic
1164411376 19:28008610-28008632 ACCAATCAGCAGGAGGTGGGTGG - Intergenic
1165434893 19:35790291-35790313 GCAGGTCAGCAGGGGGTGGGTGG - Intergenic
1165710126 19:38005092-38005114 GCTGATTGGCCGGGGGTGGGTGG - Intronic
1166003469 19:39891963-39891985 GACGACCTGAAGGCGGTGGGCGG - Exonic
1166649617 19:44562876-44562898 ACCAATCAGCAGGAGGTGGGTGG - Intergenic
1167315978 19:48762882-48762904 GATGAGCTGCAGGGTGTGGGCGG + Intergenic
1167376407 19:49114541-49114563 GCGGACCCGGAGGGGGTGGGCGG + Intronic
1167622583 19:50567877-50567899 GCGGAACCGCGGGGGGTGGGTGG - Intronic
1167743621 19:51338949-51338971 GCCGCTGAGCCGGGGGTGGGCGG + Exonic
1168246017 19:55113527-55113549 GCCGAAGTCCAGGGGGTCGGAGG + Intronic
1168246057 19:55113681-55113703 GCCCATCTGGAGGAGGCGGGAGG + Intronic
925020987 2:567676-567698 GCCGATCTGCACGGGGCCGCTGG + Intergenic
925024463 2:596566-596588 ACAGATCTGCGGGGGGTGGGGGG + Intergenic
927168640 2:20350487-20350509 GCCGATCGCCAGCGGGAGGGCGG - Intronic
928087655 2:28355953-28355975 GAGGCTCTGGAGGGGGTGGGTGG - Intergenic
928121633 2:28587941-28587963 GCCTGTCTGCAGAGGCTGGGAGG - Intronic
928493194 2:31804406-31804428 ACCAATCAGCAGGAGGTGGGTGG + Intergenic
928599070 2:32886164-32886186 GCCAATCAGCAGGATGTGGGTGG - Intergenic
930020881 2:47001464-47001486 CCTCATCTGCAGAGGGTGGGGGG + Intronic
930338631 2:50083652-50083674 ACCGATCAGCAGGATGTGGGTGG - Intronic
931800158 2:65750248-65750270 GCAGATGTGCATGGGGTGGTGGG - Intergenic
932158558 2:69439610-69439632 GCCAATCAGCAGGATGTGGGTGG - Intergenic
932462750 2:71893870-71893892 GCCGTCCTGCGGTGGGTGGGTGG + Intergenic
933139920 2:78779692-78779714 GCCAATCAGCAGGATGTGGGTGG + Intergenic
933380673 2:81539642-81539664 GCCGCTCAGCAGGAGGTGAGTGG - Intergenic
935922682 2:108032520-108032542 GCCAATCAGCAGGATGTGGGTGG + Intergenic
937608085 2:123826381-123826403 GCCAATCAGCAGGATGTGGGTGG - Intergenic
937789333 2:125942579-125942601 GCCAATCAGCAGGATGTGGGTGG - Intergenic
937920043 2:127122418-127122440 GCTGATGTGCAGGGAGAGGGAGG - Intergenic
938728941 2:134130937-134130959 GCCAATCAGCAGGATGTGGGTGG + Intronic
938761518 2:134430662-134430684 GCCTATATGGTGGGGGTGGGGGG - Intronic
939647015 2:144712551-144712573 GCAGGGCTGCAGGGGTTGGGGGG - Intergenic
939745303 2:145960090-145960112 GCCAATCAGCAGGATGTGGGTGG - Intergenic
940000569 2:148963039-148963061 GCTGACATGCAGTGGGTGGGTGG + Intronic
943441853 2:187935169-187935191 GCAGAGCTCCAAGGGGTGGGGGG + Intergenic
943443426 2:187952668-187952690 GCCAATCAGCAGGATGTGGGTGG + Intergenic
943744560 2:191448217-191448239 ACCGATCAGCAGGATGTGGGTGG + Intergenic
943868373 2:192958784-192958806 GCCAATCAGCAGGATGTGGGCGG - Intergenic
943899364 2:193412424-193412446 ACCGATCAGCAGGATGTGGGTGG - Intergenic
945451367 2:210000096-210000118 ACCAATCAGCAGGGTGTGGGTGG - Intergenic
946051055 2:216863036-216863058 GCAGATCTTTTGGGGGTGGGAGG - Intergenic
946325994 2:218985037-218985059 GTTGATCAGCAGGGGCTGGGAGG + Exonic
946929328 2:224656570-224656592 GCCAATCAGCAGGATGTGGGTGG + Intergenic
947751315 2:232534163-232534185 GCCCATCTGTGGGAGGTGGGTGG + Intronic
948501070 2:238395028-238395050 ACCGGTCTGGAGTGGGTGGGGGG + Intronic
948858257 2:240740666-240740688 GCGGATCTGCAGGGCATGAGGGG - Intronic
1169251207 20:4062817-4062839 GCTGATTGGCAGGGGGTGGAGGG + Intergenic
1169645225 20:7803143-7803165 GCCAATCAGCAGGATGTGGGTGG - Intergenic
1171318713 20:24220198-24220220 ACCAATCTGCAGGATGTGGGTGG - Intergenic
1173729078 20:45316463-45316485 GCCGCTCAGCTGGGGGAGGGTGG - Exonic
1174713078 20:52727908-52727930 GCCAATCAGCAGGATGTGGGTGG - Intergenic
1175443266 20:59005117-59005139 GGCGGGCTGCAGGGTGTGGGTGG - Intronic
1176385610 21:6137433-6137455 GCAGGGCTGCTGGGGGTGGGAGG + Intergenic
1177323836 21:19557327-19557349 GACGATATTCAGGGGGAGGGTGG + Intergenic
1178259731 21:31088059-31088081 GCCAATCAGCAGGATGTGGGTGG - Intergenic
1178561316 21:33642239-33642261 GCCAATCAGCAGGGGCTGTGTGG - Intronic
1178800617 21:35791771-35791793 GCCCACCTGCAGGTGCTGGGAGG + Intronic
1179550675 21:42141708-42141730 GTCGACCTGGTGGGGGTGGGTGG - Intronic
1179737863 21:43400819-43400841 GCAGGGCTGCTGGGGGTGGGAGG - Intergenic
1180879534 22:19194014-19194036 GCCAATCAGCAGGATGTGGGTGG - Intronic
1181003450 22:19998590-19998612 GCCTCTCTGCAGGAGCTGGGGGG + Intronic
1181570626 22:23766237-23766259 CCCCATCTGCAGGGGCTGGGGGG + Exonic
1182123985 22:27803340-27803362 ACCGACATGCCGGGGGTGGGGGG + Intergenic
1183036445 22:35144262-35144284 CCCGCTGTGGAGGGGGTGGGGGG + Intergenic
1183544348 22:38447608-38447630 GAGGAGCTGCAGGGGGTTGGGGG + Intronic
1184069481 22:42139216-42139238 GCCAATCAGCAGGATGTGGGTGG + Intergenic
1184404329 22:44291677-44291699 GATGGGCTGCAGGGGGTGGGAGG - Intronic
1184954368 22:47874086-47874108 GGAGATCTAGAGGGGGTGGGGGG - Intergenic
1185038495 22:48491505-48491527 GCTGAGCTGCTGGGGGTTGGGGG - Intronic
1185277581 22:49956507-49956529 TCCTATCTGCAGCGGGTGAGAGG + Intergenic
949723247 3:7015078-7015100 ACCCATCAGCAGGGTGTGGGCGG + Intronic
950215452 3:11155190-11155212 GCCGAACTGCAGGGGAAGGGCGG - Intronic
950371201 3:12532193-12532215 GCAGGTCTGCAGGGGCAGGGTGG - Intronic
953030622 3:39177691-39177713 GCCGATCTAGCGGGGGCGGGGGG + Intergenic
953678614 3:45022622-45022644 GCCCATCAGCAGGAGGTGAGTGG - Intronic
956438931 3:69261004-69261026 GCCAATCAGCAGGATGTGGGTGG + Intronic
956459349 3:69455203-69455225 GCCAATCAGCAGGATGTGGGTGG + Intronic
956629717 3:71304218-71304240 GCCGATGTGGAGTGAGTGGGGGG - Intronic
958130822 3:89419804-89419826 GCAGGGATGCAGGGGGTGGGAGG - Intronic
958601030 3:96297781-96297803 GCCAATCAGCAGGACGTGGGAGG + Intergenic
960020674 3:112948631-112948653 GCCGCACAGCAGGGGGTGAGCGG - Intronic
961268916 3:125672571-125672593 GCCAATCAGCAGGATGTGGGTGG + Intergenic
961340976 3:126218038-126218060 TCCCTTCTGCAGGGGTTGGGTGG + Intergenic
961391579 3:126555448-126555470 GCCGCACAGCAGGAGGTGGGTGG + Intronic
961932200 3:130546556-130546578 GCCAATCAGCAGGATGTGGGTGG - Intergenic
962650218 3:137480915-137480937 GCCCAGGGGCAGGGGGTGGGTGG - Intergenic
963508999 3:146224737-146224759 ACCAATCAGCAGGGTGTGGGTGG - Intronic
963583478 3:147155062-147155084 GCCAATCAGCAGGATGTGGGTGG + Intergenic
964032463 3:152153314-152153336 ACCAATCAGCAGGAGGTGGGTGG + Intergenic
964059265 3:152501495-152501517 GCCAATCAGCAGGATGTGGGTGG - Intergenic
965384223 3:168026619-168026641 GCAAATGTGCATGGGGTGGGAGG - Intronic
966425335 3:179774768-179774790 GCCAATCAGCAGGATGTGGGTGG - Intronic
966826758 3:183971506-183971528 GCAGATCAGCATGGGGTGGTGGG + Intronic
967106083 3:186256089-186256111 GCTGATCTGCAGAGGGTGGATGG - Intronic
967233989 3:187367262-187367284 ACCAATCTGCAGGATGTGGGTGG - Intergenic
968002004 3:195212535-195212557 GCCGCACAGCAGGCGGTGGGAGG + Intronic
968292659 3:197550690-197550712 GCCGATCTGCAGGGGGTGGGGGG + Intronic
968543341 4:1179670-1179692 ACAGAGCTGGAGGGGGTGGGTGG - Intronic
968585524 4:1414459-1414481 GCCTGTCTGCAGGAGGTGGGTGG + Intergenic
968585565 4:1414581-1414603 GCCTGTCTGCAGGAGGTGGGTGG + Intergenic
968803277 4:2756513-2756535 GCCGGGCTGTAGGCGGTGGGAGG - Intergenic
969049652 4:4363631-4363653 GCAGCTCTGGAGGGGCTGGGAGG + Intronic
970574450 4:17413767-17413789 GCCAATCAGCAGGATGTGGGTGG - Intergenic
972667790 4:41183825-41183847 GGGGAGTTGCAGGGGGTGGGAGG + Intronic
972791321 4:42373929-42373951 GCCAATCAGCAGGATGTGGGTGG - Intergenic
973048708 4:45567924-45567946 ACCGATCAGCAGGGTGTGGGTGG + Intergenic
977400201 4:96522036-96522058 GCCAATCAGCAGGATGTGGGTGG + Intergenic
977507813 4:97923921-97923943 GCCAATCAGCAGGATGTGGGTGG + Intronic
977726507 4:100302673-100302695 CTCCATCTGCAGTGGGTGGGGGG - Intergenic
977821614 4:101478474-101478496 GCCAATCAGCAGGATGTGGGCGG + Intronic
977885260 4:102245671-102245693 GCCAATCAGCAGGATGTGGGTGG + Intergenic
978285712 4:107074065-107074087 GCCAATCAGCAGGATGTGGGTGG + Intronic
978466374 4:109013397-109013419 GCCAATCAGCAGGATGTGGGTGG + Intronic
979829488 4:125281867-125281889 GCCAATCAGCAGGATGTGGGTGG + Intergenic
979865329 4:125745779-125745801 GCCGCTCAGCAGGATGTGGGTGG + Intergenic
980383894 4:132062260-132062282 GCCAATCGGCAGGATGTGGGTGG - Intergenic
981136328 4:141214495-141214517 GCCCATCAGCAGGATGTGGGTGG + Intergenic
981591318 4:146365879-146365901 GCCGCACTGCAGGAGGTGAGTGG + Intronic
982036758 4:151353490-151353512 ACCGATCGGCAGGATGTGGGCGG - Intergenic
983135073 4:164069270-164069292 GCCAATCAGCAGGATGTGGGTGG + Intronic
983843069 4:172481472-172481494 GCCAATCAGCAGGATGTGGGTGG - Intronic
984805219 4:183745924-183745946 GCCAATCAGCAGGATGTGGGTGG - Intergenic
985269417 4:188179735-188179757 GCCAATCAGCAGGATGTGGGAGG + Intergenic
985298449 4:188460343-188460365 GCCAATCAGCAGGACGTGGGTGG + Intergenic
985341517 4:188959628-188959650 GCTGATCTGCAGGGAGCTGGGGG + Intergenic
985548041 5:519818-519840 GCCGCTCAGAGGGGGGTGGGGGG + Intronic
985566735 5:622443-622465 GCTGCTCTGCAAGGGCTGGGAGG + Intronic
985593543 5:777596-777618 GCCAATCAGCAGGATGTGGGTGG - Intergenic
986919142 5:12662680-12662702 GCCAATCAGCAGGATGTGGGTGG + Intergenic
987099313 5:14578184-14578206 GCCAATCAGCAGGATGTGGGTGG + Intergenic
987877071 5:23691851-23691873 GCCAATCAGCAGGATGTGGGTGG + Intergenic
988060334 5:26159319-26159341 TCCAATTTGCAGGGGGTGGGTGG + Intergenic
988201638 5:28077093-28077115 GCCAATCAGCAGGATGTGGGTGG - Intergenic
989003331 5:36783348-36783370 ACCAATCAGCAGGAGGTGGGTGG + Intergenic
990528366 5:56650628-56650650 GCCGTGCTGCAGAGGGTGGGAGG - Intergenic
994570425 5:101506941-101506963 GCCAATCAGCAGGATGTGGGTGG + Intergenic
995183885 5:109252347-109252369 TCTGTTCTGCTGGGGGTGGGAGG + Intergenic
995388203 5:111611640-111611662 ACCAATCGGCAGGGTGTGGGTGG - Intergenic
995915156 5:117236631-117236653 GCCTGTCCGGAGGGGGTGGGAGG - Intergenic
996557659 5:124795959-124795981 CCCAAAATGCAGGGGGTGGGGGG - Intergenic
997215165 5:132103937-132103959 TCCTTTCTGCAGTGGGTGGGGGG - Intergenic
997360547 5:133292043-133292065 GCCCATCTCCATGGGCTGGGTGG - Intronic
997579892 5:135010628-135010650 GCTGATGGGCAGTGGGTGGGTGG + Intronic
997829132 5:137133942-137133964 GCAGATGGGCTGGGGGTGGGGGG + Intronic
998117684 5:139550472-139550494 GCCAATCAGCAGGATGTGGGTGG + Intronic
998130258 5:139648242-139648264 GCCGAGGTGGAGGGGGTTGGGGG + Intronic
998691809 5:144595599-144595621 GCCAATCAGCAGGATGTGGGTGG + Intergenic
999754479 5:154654002-154654024 GAGGAGCTGCAGGTGGTGGGTGG - Intergenic
999966400 5:156814401-156814423 GCCTATCGCCAGGGGGTTGGAGG + Intergenic
1000568701 5:162883384-162883406 GCCAATCAGCAGGATGTGGGTGG + Intergenic
1001193895 5:169654433-169654455 GCCGATCTGCAGGGAGAGCTGGG - Exonic
1001454019 5:171847084-171847106 GCAGACCTGCTGGGAGTGGGAGG - Intergenic
1001962715 5:175889780-175889802 GACAACCTGCAAGGGGTGGGGGG - Intergenic
1002131950 5:177087185-177087207 GCCGGGCGGCAGGGGGTGGAGGG + Intronic
1002199628 5:177520443-177520465 GTCCATCAGCAGGGGCTGGGAGG + Intronic
1002382238 5:178839205-178839227 ACAGATCTGGAGGGGGTGGTGGG + Intergenic
1002612887 5:180432826-180432848 GCCAATCAGCAGGATGTGGGTGG + Intergenic
1002758130 6:180328-180350 GCCAATCAGCAGGATGTGGGTGG + Intergenic
1003111387 6:3254339-3254361 GCCAATCAGCAGGATGTGGGTGG + Intronic
1003178612 6:3772501-3772523 GCCAATCAGCAGGATGTGGGTGG + Intergenic
1003507269 6:6750311-6750333 GCAGAGGTGCAGGGGGAGGGGGG + Intergenic
1003532987 6:6953174-6953196 GCCAATCAGCAGGATGTGGGTGG + Intergenic
1003578147 6:7315902-7315924 ACCAATCAGCAGGGTGTGGGTGG + Intronic
1003983858 6:11416541-11416563 GCCAATCAGCAGGATGTGGGTGG - Intergenic
1004250423 6:14018750-14018772 GCCAATCAGCAGGATGTGGGTGG + Intergenic
1005705259 6:28444896-28444918 GCCAATCAGCAGGATGTGGGCGG - Intergenic
1006366868 6:33621244-33621266 GGCGAGCTGCGGGGGGAGGGGGG + Exonic
1006434003 6:34016717-34016739 GCCAATCAGCAGGATGTGGGTGG - Intergenic
1006497851 6:34436962-34436984 GCCAATCTGCAGGATGTGGGTGG - Intergenic
1006535648 6:34696790-34696812 GCGGAGCTGGGGGGGGTGGGAGG - Exonic
1006836337 6:37001111-37001133 GCCGTACTGCAGGAGGTGAGTGG + Intergenic
1007284186 6:40736064-40736086 GCCAATCTCCAGCTGGTGGGAGG - Intergenic
1007396103 6:41578697-41578719 GGAGATCTGTGGGGGGTGGGCGG + Intronic
1007553390 6:42746723-42746745 GCCGAACTGCAGTGGATAGGGGG - Intergenic
1007627698 6:43255538-43255560 GCCCATCTCCTGGAGGTGGGGGG - Exonic
1007776906 6:44229035-44229057 GCCGAAGGGCAGGGGGTGGGTGG - Intronic
1009827323 6:68883343-68883365 GCCAATCAGCAGGATGTGGGTGG + Intronic
1011477178 6:87759554-87759576 GACCATCTGCATGGGGTAGGAGG - Intergenic
1012145154 6:95670955-95670977 GCCGATCAGGAGGGTGTGGGTGG + Intergenic
1012598367 6:101066129-101066151 GCCAATCAGCAGGATGTGGGTGG - Intergenic
1012999898 6:106011619-106011641 GCAGCTTTGCAGGGGGCGGGGGG - Intergenic
1016858796 6:148697639-148697661 ACCGATCAGCAGGATGTGGGTGG - Intergenic
1017824130 6:158069209-158069231 CCAGTTCAGCAGGGGGTGGGGGG - Intronic
1017962332 6:159233212-159233234 GCCCATCTCCCGGGGCTGGGAGG + Exonic
1018677562 6:166236117-166236139 GCTGGTGGGCAGGGGGTGGGGGG - Intergenic
1018740153 6:166722383-166722405 GAGGAGCCGCAGGGGGTGGGAGG + Intronic
1019156161 6:170040198-170040220 GTCTTTCTGCAGGGGGTGGAAGG - Intergenic
1019309549 7:353414-353436 CAGGGTCTGCAGGGGGTGGGGGG + Intergenic
1019636267 7:2077670-2077692 GCCGTTCTGCAGGAGGCGCGCGG + Intronic
1020846635 7:13293533-13293555 GTCAAACAGCAGGGGGTGGGGGG - Intergenic
1021513674 7:21460607-21460629 GCCAATCAGCAGGATGTGGGTGG - Intronic
1023255889 7:38311663-38311685 CCCCATCTGCAGGGGCTGGGGGG - Intergenic
1023793020 7:43768881-43768903 GCTGACCCGCAGGTGGTGGGTGG - Intronic
1024782251 7:52865001-52865023 GCCCCTCTGCTGGGGGTGGTGGG - Intergenic
1025953113 7:66161640-66161662 GGTGGTCTCCAGGGGGTGGGTGG + Intergenic
1026516668 7:71078556-71078578 GCCAATCAGCAGGATGTGGGTGG + Intergenic
1026551606 7:71373522-71373544 GCCGAACAGCAGGAGGTGAGCGG + Intronic
1027390372 7:77697156-77697178 GCCGGCCTGGAGGGGCTGGGAGG + Intronic
1028414764 7:90567783-90567805 GATCATCTGCAGGGGATGGGAGG + Intronic
1028727307 7:94102018-94102040 GCCAATCAGCAGGATGTGGGTGG + Intergenic
1029065211 7:97842360-97842382 GCCAATCAGCAGGATGTGGGTGG - Intergenic
1029274749 7:99397456-99397478 GTCCATCTGCAGGGCTTGGGAGG - Intronic
1029440339 7:100583740-100583762 ACCGTTCTGGAGAGGGTGGGGGG + Intronic
1029809519 7:103033836-103033858 ACCGATCAGCAGGATGTGGGTGG - Intronic
1031056401 7:116997325-116997347 GCCAATCAGCAGGATGTGGGTGG - Intronic
1031605397 7:123762615-123762637 GCCAATCAGCAGGATGTGGGTGG - Intergenic
1032028128 7:128459788-128459810 GTCCTTTTGCAGGGGGTGGGGGG - Intergenic
1032885009 7:136128209-136128231 GCTCATCTGCAGGGGGCGTGAGG + Intergenic
1034272690 7:149811116-149811138 GCCGAGGGGCTGGGGGTGGGGGG - Intergenic
1034433449 7:151052074-151052096 CCCCCACTGCAGGGGGTGGGAGG + Intronic
1034869863 7:154674433-154674455 GTTGATCTGCAAGGGGAGGGAGG + Intronic
1035477554 7:159154007-159154029 TCAGCTGTGCAGGGGGTGGGAGG + Intergenic
1036307861 8:7615029-7615051 GGCTCTCAGCAGGGGGTGGGAGG + Intergenic
1036358716 8:8063030-8063052 GGCTCTCAGCAGGGGGTGGGAGG + Intergenic
1036801482 8:11795515-11795537 ACCAATCAGCAGGGTGTGGGTGG + Intergenic
1036892243 8:12603922-12603944 GGCTCTCAGCAGGGGGTGGGAGG - Intergenic
1036899788 8:12661898-12661920 GGCTCTCAGCAGGGGGTGGGAGG - Intergenic
1037957423 8:23070374-23070396 ACCAATCAGCAGGGTGTGGGTGG - Intergenic
1038055973 8:23858053-23858075 GCCCAAGTGCAGTGGGTGGGAGG + Intergenic
1038610820 8:29058830-29058852 GCCGGTGTGCAAGGGCTGGGTGG - Intronic
1040965453 8:53077199-53077221 GCCAATCAGCAGGATGTGGGTGG - Intergenic
1041471273 8:58212032-58212054 GCCTCTCTGCAGGGGGCGGTGGG - Intergenic
1043305061 8:78783352-78783374 GCCCACCTGCAGGGGGTAAGTGG - Intronic
1043725862 8:83610568-83610590 GCCAATCAGCAGGGTGTGGGTGG - Intergenic
1045096334 8:98801300-98801322 GCCAATCAGCAGGATGTGGGTGG + Intronic
1045678287 8:104632340-104632362 GCCAATCAGCAGGATGTGGGTGG - Intronic
1045960704 8:107964690-107964712 TCTGCTTTGCAGGGGGTGGGGGG + Intronic
1048455142 8:134570911-134570933 GCCAATCTGCTGGGGGTGAGAGG + Intronic
1048636290 8:136299532-136299554 GGCGATATGCTGGGGATGGGTGG + Intergenic
1049056894 8:140243891-140243913 GCCGCACAGCAGGAGGTGGGTGG + Intronic
1049164841 8:141119311-141119333 GCCCATGTGCGGGGGCTGGGCGG + Intronic
1049223142 8:141436949-141436971 CCCCATCTGCACTGGGTGGGGGG + Intergenic
1049775284 8:144401145-144401167 ACCCAGCTGCAGGGGGAGGGAGG + Intronic
1051928914 9:22362834-22362856 GCCAATCAGCAGGAAGTGGGTGG - Intergenic
1052651693 9:31311667-31311689 CCCGGTGGGCAGGGGGTGGGTGG - Intergenic
1052883756 9:33623565-33623587 AGCAATATGCAGGGGGTGGGGGG + Intergenic
1055102449 9:72479821-72479843 ACCAATCAGCAGGGTGTGGGTGG - Intergenic
1055530292 9:77177288-77177310 GCTGATCTGCAGGAGGGGGCGGG + Intergenic
1056096270 9:83257363-83257385 GCCTGTCGGCAGGGGGTTGGGGG + Intronic
1056098719 9:83279790-83279812 GCCTGTCAGCAGGGGGTCGGGGG + Intronic
1057142713 9:92737291-92737313 TCCTATCGTCAGGGGGTGGGTGG - Intronic
1057487167 9:95494619-95494641 GTCGCTCTGCAGGAAGTGGGCGG + Intronic
1057907047 9:98991263-98991285 GCCAATCAGCAGGATGTGGGGGG - Intronic
1058065048 9:100539785-100539807 ACCAATCTGCAGGATGTGGGTGG - Intronic
1058585257 9:106500898-106500920 ACCAATCAGCAGGGTGTGGGTGG - Intergenic
1058842613 9:108924787-108924809 GCTGGTCTGTAAGGGGTGGGTGG - Intronic
1060931109 9:127490055-127490077 GCCGGCCTGCGGGGGGTGGGGGG - Intronic
1061149589 9:128821226-128821248 GCAGACCTGCAGGGGGAAGGCGG - Exonic
1061413492 9:130433246-130433268 GCGGAACTGCAGGGGCTGGCAGG + Intronic
1061856362 9:133443807-133443829 GCCGACCTGCCTGGGGAGGGGGG + Intronic
1062366022 9:136209427-136209449 GCCGAACTGCAAGGGACGGGTGG - Intronic
1062564271 9:137157023-137157045 GCCGCTCTTCAAGAGGTGGGCGG + Exonic
1186399114 X:9240738-9240760 CCCAGCCTGCAGGGGGTGGGGGG - Intergenic
1187010489 X:15273636-15273658 ACCAATCTGCAGGATGTGGGCGG + Intergenic
1189952187 X:46244266-46244288 GCCAATCAGCAGGATGTGGGTGG - Intergenic
1190635003 X:52424803-52424825 GTCAGTCTGCAGAGGGTGGGAGG - Intergenic
1190649694 X:52556885-52556907 GTCAGTCTGCAGAGGGTGGGAGG + Intergenic
1190654267 X:52597328-52597350 GTCAGTCTGCAGAGGGTGGGAGG + Intergenic
1190683877 X:52853092-52853114 GGCAGTCTGCAGAGGGTGGGAGG + Intergenic
1190700012 X:52980644-52980666 GGCAGTCTGCAGAGGGTGGGAGG + Intronic
1193145737 X:78073821-78073843 ACCAATCAGCAGGGTGTGGGTGG - Intronic
1194118019 X:89926660-89926682 ACCAATCAGCAGGAGGTGGGTGG + Intergenic
1194413957 X:93587876-93587898 ACCGAACTGGAGGGGGAGGGTGG - Intergenic
1196126746 X:112109467-112109489 ACCAATCAGCAGGAGGTGGGTGG - Intergenic
1196405895 X:115362270-115362292 GCCAATCAGCAGGATGTGGGCGG + Intergenic
1198098202 X:133400899-133400921 GTGTGTCTGCAGGGGGTGGGGGG + Intronic
1198256244 X:134926313-134926335 GCCAATCAGCAGGATGTGGGTGG + Intergenic
1199831685 X:151554800-151554822 ACCAATCAGCAGGGTGTGGGTGG - Intergenic
1200116446 X:153771749-153771771 GCCGAGCTGCTGGGGTTTGGGGG - Intronic
1200955453 Y:8939355-8939377 GCCAATCAGCAGGATGTGGGTGG + Intergenic
1201260844 Y:12157933-12157955 GCCAATCAGCAGGATGTGGGTGG - Intergenic
1201403396 Y:13627624-13627646 ACCGATCAGCAGGATGTGGGTGG + Intergenic
1202100467 Y:21303053-21303075 GCCAATCAGCAGGATGTGGGTGG - Intergenic