ID: 968292809

View in Genome Browser
Species Human (GRCh38)
Location 3:197552052-197552074
Sequence TGCGCAGTTGTCTGAGTTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 90}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968292809 Original CRISPR TGCGCAGTTGTCTGAGTTCA GGG (reversed) Intronic
901630809 1:10647329-10647351 TGCACAGTGGTCTGAGCTCTTGG - Intronic
902055077 1:13594100-13594122 TTCACAGTTTTCAGAGTTCATGG - Intronic
908415630 1:63910759-63910781 TGTGCAGTGGCCTGAGTGCAAGG - Intronic
912583440 1:110739856-110739878 TGTGCAGGTGTCTGGGTTCAGGG - Intergenic
912959226 1:114180691-114180713 TGCTGTGTTCTCTGAGTTCAAGG - Intergenic
1063682678 10:8204767-8204789 TGACCAGTTGTCTTACTTCAAGG - Intergenic
1064155610 10:12900985-12901007 TGGGCAGTTCTCTTAGGTCAGGG - Intronic
1072691862 10:97577567-97577589 TGGGCAGGTGTCTGAGCTCAGGG + Intronic
1081530263 11:43953738-43953760 TGGGCAATTCTCAGAGTTCAGGG - Intergenic
1082926696 11:58554867-58554889 TGCTCAGTTGGATGAGCTCATGG - Exonic
1086218230 11:84408836-84408858 TGTGCTGCTGTCTTAGTTCAGGG + Intronic
1086864719 11:91966531-91966553 TGCCCAGATGTCTGAGGTCATGG + Intergenic
1088087680 11:106001191-106001213 TGAGCTGGTGTTTGAGTTCATGG + Intronic
1091100771 11:132871262-132871284 TGTGCAGTTGATTGAATTCATGG - Intronic
1094314401 12:29121909-29121931 TGCGTAGTTTACTGCGTTCATGG - Intergenic
1100651638 12:96596233-96596255 TGCTCAATTGGCTGAGTTTACGG + Intronic
1103800181 12:123533070-123533092 TGCGCACGTGTGTGTGTTCAGGG - Intronic
1116292651 14:43063032-43063054 TGCTCAGTGGTCAGGGTTCAGGG - Intergenic
1117003918 14:51399036-51399058 TGAGCAGTTTGCTGAGTTTAGGG - Intergenic
1122375326 14:101253298-101253320 TGTGCAGTTCTCTCAGTCCAGGG + Intergenic
1122881548 14:104692650-104692672 TGGGCAGTTGTCTGTCTGCATGG - Intronic
1126434800 15:48625433-48625455 TGTGGAGTTGCCTGAGTTTAAGG - Intronic
1130526453 15:84711153-84711175 TGGGCAGATGGCTGAGCTCAGGG + Intronic
1132273842 15:100549293-100549315 TGTGCAGTTGTTTGAGGGCATGG + Intergenic
1133599182 16:7322618-7322640 TGCGCAGTTTTCTGGGATGAGGG + Intronic
1134245198 16:12534528-12534550 AGGGCAGTTGTGTCAGTTCAGGG + Intronic
1135097839 16:19579286-19579308 TGTGCAGTTGGCCGAGCTCACGG + Intronic
1143368996 17:6426777-6426799 TGGGCAGCTGCCTGAGGTCATGG - Intronic
1147548491 17:41421476-41421498 AGAGCAGTTGTCTGAGATCCGGG - Exonic
1151401221 17:73857278-73857300 TCCACAGGTGTCTGAGTCCAAGG + Intergenic
1153408948 18:4771800-4771822 TGTGCAGGTGCCTGAGTTCATGG - Intergenic
1157530296 18:48414519-48414541 TGCCCAGCTGTCTGAGTTATAGG + Intergenic
1164910959 19:32011561-32011583 TGAACAATTGTCTTAGTTCATGG - Intergenic
1166522297 19:43488674-43488696 TGCAAAGTGATCTGAGTTCAAGG + Intronic
1167133142 19:47600617-47600639 CGCGCAGTTGCCTGATTTCGTGG + Intergenic
926906873 2:17814111-17814133 TGCTGATTTGTGTGAGTTCAAGG - Intergenic
930718048 2:54611890-54611912 TGAGCATTTGTTTAAGTTCAGGG - Intronic
933036058 2:77399903-77399925 AGCCCAGATGTCTGACTTCATGG - Intronic
936146356 2:109982784-109982806 TGCTCAGCTGTGTGAGTTCCAGG + Intergenic
936198335 2:110388695-110388717 TGCTCAGCTGTGTGAGTTCCAGG - Intergenic
938199148 2:129358647-129358669 TGCACACTTGTCTGAGTCCCAGG - Intergenic
941831942 2:169971186-169971208 TGTGAATTTGTTTGAGTTCATGG + Intronic
946061140 2:216942536-216942558 TGCGCAGTTGACTTGGTTCCAGG + Intergenic
1169577843 20:6985680-6985702 TGTGCTGTTGTCTGAGAACATGG - Intergenic
1171475090 20:25402579-25402601 TGGGAAGTTTTCTGAATTCAGGG - Intergenic
1172707788 20:36895303-36895325 TGAGGAGTTGTCTGGGTTAAGGG - Intronic
1177248447 21:18561805-18561827 TCTGCAGTTGCCTGAGTTCCTGG + Intergenic
1182618945 22:31607773-31607795 TGCTCAGTGGTCTGCGTGCAAGG + Intronic
1184846239 22:47089516-47089538 TGCGCACATGTCTGTGTGCATGG - Intronic
949692034 3:6651709-6651731 TGGTGAGTTGTCTGAATTCATGG - Intergenic
950190339 3:10972125-10972147 TGGGCAGTTTTCTGAGAACAAGG - Intergenic
953337617 3:42107118-42107140 TGAGCAGCTGCCAGAGTTCAAGG - Intronic
954331813 3:49895224-49895246 TGCGCTCTTGGCTGAGGTCAAGG - Exonic
956693139 3:71896034-71896056 TGAGTAGTTCTTTGAGTTCAGGG - Intergenic
956906616 3:73772380-73772402 TTTTCAGCTGTCTGAGTTCATGG + Intergenic
959793606 3:110394797-110394819 AGCCCAGTTGTCTGGCTTCATGG - Intergenic
959871761 3:111337133-111337155 TGGGCATTTGCCTGATTTCATGG + Intronic
962385153 3:134926985-134927007 TGGGCAGTTGGCTAATTTCAGGG + Intronic
966771553 3:183508443-183508465 AACGCAGTTTTCTGGGTTCAAGG + Exonic
968292809 3:197552052-197552074 TGCGCAGTTGTCTGAGTTCAGGG - Intronic
971525472 4:27612273-27612295 TGAGCAGTTTACTGATTTCAAGG + Intergenic
973617561 4:52694266-52694288 TGAACTGTTGTCTGAGTGCATGG - Intergenic
976104187 4:81599401-81599423 TGCACAGTTTGCTGAGGTCATGG + Intronic
976335864 4:83885518-83885540 AGCTCAGTTGTGTGAGTTAAAGG - Intergenic
976368925 4:84264697-84264719 TGTTGAGTTGTTTGAGTTCATGG - Intergenic
980292764 4:130866345-130866367 CTGGCAATTGTCTGAGTTCATGG + Intergenic
989291152 5:39767927-39767949 TGCCCAGTTGTCCCAGTTCTGGG + Intergenic
991320559 5:65368992-65369014 TGGGCAGTGGGCTGAGATCAAGG + Intronic
996330496 5:122323131-122323153 GGCGCTGTTGCCCGAGTTCATGG - Intronic
997505387 5:134412576-134412598 TGAGCAGTTTTCTGAGTAAAGGG + Intergenic
998527564 5:142856600-142856622 TCCGCAGTTGACTGAACTCATGG - Intronic
1002776794 6:335243-335265 TGTGAAGTTGTCAGAGCTCACGG + Intronic
1007118681 6:39362581-39362603 TGGGCAGATGACAGAGTTCAAGG + Intronic
1010990726 6:82477293-82477315 TGCTCAGTTTTCTGAGGTAAGGG + Intergenic
1012567065 6:100670660-100670682 TCCGCAGTTGGCTGAATTCATGG + Intronic
1019299943 7:297829-297851 TGCGGAGGGGTCTGAGCTCAGGG + Intergenic
1021132130 7:16924111-16924133 GTGGCAGTTGTCTAAGTTCATGG + Intergenic
1021588520 7:22236305-22236327 TGCCCACTTCTCTGAGTTCCAGG + Intronic
1028504799 7:91559123-91559145 AGAGCAGTTGTCTGATTCCAGGG + Intergenic
1029737892 7:102474525-102474547 TTAGGAGTTGTCTGAGGTCAGGG + Exonic
1034588245 7:152115523-152115545 TGTGCAGTTGTTTGAGTTATGGG + Intronic
1034915082 7:155032063-155032085 TAAGCAATTGCCTGAGTTCAGGG + Intergenic
1035378211 7:158421045-158421067 TGCTCAAGTATCTGAGTTCAAGG + Intronic
1035787469 8:2272993-2273015 AGAGCAGATGTCTGAGGTCATGG - Intergenic
1035805338 8:2448723-2448745 AGAGCAGATGTCTGAGGTCATGG + Intergenic
1037522162 8:19690832-19690854 TGTTCAGATGTCTGAGATCAGGG + Intronic
1040387135 8:46921255-46921277 TGCGGAGTTGTCTGGGTGAAGGG + Intergenic
1041719603 8:60964226-60964248 TGCTCAGGTGTCTGAAATCAAGG + Intergenic
1042176480 8:66042003-66042025 TGCCCAGTTGTTTTTGTTCAGGG + Intronic
1050016709 9:1241391-1241413 TGGACACTTGTATGAGTTCATGG + Intergenic
1059929492 9:119247061-119247083 TGTGCTCTTGTCTGAGTTCCTGG - Intronic
1062345942 9:136115351-136115373 GGCGCAGATGCCTGTGTTCAGGG - Exonic
1196007571 X:110852361-110852383 GGCGCAGTTGTATGAGTTGGTGG - Intergenic
1199582615 X:149375583-149375605 TGCTCAGTTGCCTGTGTGCATGG - Intergenic
1199740719 X:150733854-150733876 TGCCCAGGTGTCTGACTTGAGGG + Intronic
1201316194 Y:12648657-12648679 TGCGAATTTGTTTGAGTTCATGG - Intergenic
1201408959 Y:13679119-13679141 TGCTAATTTGTTTGAGTTCATGG - Intergenic