ID: 968298552

View in Genome Browser
Species Human (GRCh38)
Location 3:197595723-197595745
Sequence CATCACAGGGAGGAAGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968298552_968298557 5 Left 968298552 3:197595723-197595745 CCTTCCACTTCCTCCCTGTGATG No data
Right 968298557 3:197595751-197595773 AGAATGAATTCCAACTCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968298552 Original CRISPR CATCACAGGGAGGAAGTGGA AGG (reversed) Intergenic
No off target data available for this crispr