ID: 968299197

View in Genome Browser
Species Human (GRCh38)
Location 3:197600339-197600361
Sequence CCCGGCAGCCTGTTTTGTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 72}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968299189_968299197 16 Left 968299189 3:197600300-197600322 CCAGGATGGCTCACCTGGAGGCG 0: 1
1: 0
2: 0
3: 5
4: 123
Right 968299197 3:197600339-197600361 CCCGGCAGCCTGTTTTGTACAGG 0: 1
1: 0
2: 0
3: 2
4: 72
968299191_968299197 3 Left 968299191 3:197600313-197600335 CCTGGAGGCGGCGCTCCCATACG 0: 1
1: 0
2: 0
3: 1
4: 41
Right 968299197 3:197600339-197600361 CCCGGCAGCCTGTTTTGTACAGG 0: 1
1: 0
2: 0
3: 2
4: 72
968299188_968299197 17 Left 968299188 3:197600299-197600321 CCCAGGATGGCTCACCTGGAGGC 0: 1
1: 0
2: 0
3: 18
4: 177
Right 968299197 3:197600339-197600361 CCCGGCAGCCTGTTTTGTACAGG 0: 1
1: 0
2: 0
3: 2
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968299197 Original CRISPR CCCGGCAGCCTGTTTTGTAC AGG Intergenic