ID: 968299197

View in Genome Browser
Species Human (GRCh38)
Location 3:197600339-197600361
Sequence CCCGGCAGCCTGTTTTGTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 72}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968299191_968299197 3 Left 968299191 3:197600313-197600335 CCTGGAGGCGGCGCTCCCATACG 0: 1
1: 0
2: 0
3: 1
4: 41
Right 968299197 3:197600339-197600361 CCCGGCAGCCTGTTTTGTACAGG 0: 1
1: 0
2: 0
3: 2
4: 72
968299189_968299197 16 Left 968299189 3:197600300-197600322 CCAGGATGGCTCACCTGGAGGCG 0: 1
1: 0
2: 0
3: 5
4: 123
Right 968299197 3:197600339-197600361 CCCGGCAGCCTGTTTTGTACAGG 0: 1
1: 0
2: 0
3: 2
4: 72
968299188_968299197 17 Left 968299188 3:197600299-197600321 CCCAGGATGGCTCACCTGGAGGC 0: 1
1: 0
2: 0
3: 18
4: 177
Right 968299197 3:197600339-197600361 CCCGGCAGCCTGTTTTGTACAGG 0: 1
1: 0
2: 0
3: 2
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968299197 Original CRISPR CCCGGCAGCCTGTTTTGTAC AGG Intergenic
903876483 1:26477787-26477809 CCCAGCAGCCTGTGTTTCACTGG + Intergenic
914196730 1:145451654-145451676 CCAGGCAGCCTGGGTTGTGCAGG - Intergenic
914783135 1:150803952-150803974 CCCAGCATGATGTTTTGTACTGG - Intronic
917801872 1:178579145-178579167 CCCGGCCGCCTGCTTTGGAAAGG - Intergenic
920506360 1:206518121-206518143 CCCTGCAGCCTGTTTGGTGGGGG + Intronic
1065778467 10:29144287-29144309 GCCGGCAGCCTGTGTGGGACTGG + Intergenic
1066186431 10:33014148-33014170 CCCAGTGGCCTGTTTTGTCCGGG - Intergenic
1066190397 10:33050084-33050106 CCCAGTGGCCTGTTTTGTCCGGG - Intergenic
1067134128 10:43593349-43593371 CCTGGCAGCAGCTTTTGTACTGG + Intergenic
1071279824 10:84090817-84090839 CCCTTCAGCCTCTTTTGTAAGGG + Intergenic
1073456716 10:103641287-103641309 CCAGGCAGCCTGAGTTGTGCAGG + Intronic
1075740700 10:124694310-124694332 CCCAGCAACCTGCTTTCTACCGG - Intronic
1076130969 10:128013667-128013689 CCCTGGAGCCTATTTTGTAAGGG - Intronic
1078739676 11:14054848-14054870 CCAGGCAGCTGGCTTTGTACAGG + Intronic
1078743564 11:14090870-14090892 CCCAGTAGCCTGTTTTGTCAGGG + Intronic
1084579949 11:70017005-70017027 CCCGGCAGCCTGGATTCTAGAGG - Intergenic
1091373783 12:13408-13430 CCCGGCACCCTGTCCTGGACAGG + Intergenic
1091620389 12:2083350-2083372 CCAGGCAGCCTGTGTTGTTGAGG + Intronic
1093403103 12:18770943-18770965 CCCTGCACTCTGTTTTGGACTGG - Intergenic
1106811086 13:33359016-33359038 CCCAGTAGCCTGTTTTGTCAGGG - Intergenic
1113503823 13:110799269-110799291 CCAGGCAGCCTGTGGTGTAGGGG - Intergenic
1114170120 14:20263955-20263977 CCCATCAGCCTGTTGAGTACTGG - Intronic
1119731415 14:76953622-76953644 CCAGGCAGCCTGTTCTGCCCAGG + Intergenic
1122379350 14:101290490-101290512 CCCCGCAGCTTCCTTTGTACAGG - Intergenic
1123833398 15:24164652-24164674 CCCAGCAGTCTGTTTTGTTTTGG + Intergenic
1132454075 16:12962-12984 CCCGGCACCCTGTCCTGGACAGG + Intergenic
1149883395 17:60315836-60315858 GCAGGCAATCTGTTTTGTACAGG - Intronic
1151820684 17:76495139-76495161 CCCGGCAGCCGGGTTTTCACGGG + Intronic
1152253152 17:79222181-79222203 ACCTGCAGCCTGATTTCTACCGG + Intronic
1160014171 18:75127865-75127887 GCCGGCTGCCCGCTTTGTACAGG - Intergenic
1162951722 19:14075061-14075083 CACTGCAGCCTGTTTTTTTCTGG + Exonic
1163604152 19:18265052-18265074 CCCGGCAGCCTGTGAGGTCCAGG - Exonic
1164033941 19:21436779-21436801 CCTGGCAGCAGTTTTTGTACAGG + Intronic
1165808705 19:38597338-38597360 CCCGGCAGCCTTTGGTGTCCTGG + Exonic
1167402900 19:49284741-49284763 CCCAACAGTCTGTTTTGTTCTGG - Intergenic
948840546 2:240646798-240646820 GCCGGCAGCCTCTTCTGTAAAGG + Intergenic
1179260158 21:39750848-39750870 CCAGGCAGCATGTTTTGGGCAGG + Intronic
1179731035 21:43367622-43367644 CCCCTCAGGCTGTTTTGCACGGG - Intergenic
1182082583 22:27539712-27539734 CCTGGGAGCCTGTTTGCTACAGG + Intergenic
958858673 3:99418784-99418806 CCAGGAAGCCTGTTTTGCAAAGG - Intergenic
960640707 3:119820130-119820152 CACGGCAGCTTGTTTTTTCCTGG + Intergenic
966062700 3:175778798-175778820 CCAGGAAGCTTGTCTTGTACGGG + Intronic
968299197 3:197600339-197600361 CCCGGCAGCCTGTTTTGTACAGG + Intergenic
968452268 4:681249-681271 CCCGGGGGCCTGTTCTGTCCTGG - Intronic
971634952 4:29046439-29046461 CTCTGCAGCCTCTTTTGTAAGGG + Intergenic
974087379 4:57275940-57275962 CCAGGCAGTCTGTTTTCTTCTGG + Intergenic
976305642 4:83556935-83556957 CCCAGCTTCCTGGTTTGTACAGG + Intronic
979105186 4:116676691-116676713 CCGGGAAGTCTGTTTTGTCCAGG + Intergenic
979635262 4:122949508-122949530 CCCAGCAGTCTGTTTTCTTCTGG + Intronic
982092953 4:151896372-151896394 CCCAACAGTCTGTTTTGTTCTGG + Intergenic
983010785 4:162544250-162544272 CCCAGCACCATGTTTTGAACAGG + Intergenic
984253261 4:177359930-177359952 CCAGGCAGCCTGTTTCTTGCAGG + Intronic
986183554 5:5416548-5416570 CCTGGCAGCCGGTTCTGTCCTGG - Intergenic
1001424218 5:171612936-171612958 TCTGGCAGAATGTTTTGTACTGG - Intergenic
1003148477 6:3528795-3528817 CCTGGGAGCCTGTTGTGCACGGG - Intergenic
1005013394 6:21356801-21356823 CCCAACAGTCTGTTTTGTTCTGG + Intergenic
1014694690 6:124604922-124604944 CCTGGCAGAATGTCTTGTACAGG + Intronic
1017598072 6:156050846-156050868 CCCTGTAGTCTGTTTTGTAAAGG - Intergenic
1023113405 7:36837374-36837396 CCCTGAAGCCTGTTTTATAAAGG + Intergenic
1024299654 7:47877204-47877226 CCCTGCAGCCTGGTTAGAACAGG - Intronic
1027497936 7:78911427-78911449 CCTGGAAGCCTTTTTTGTAAAGG - Intronic
1030715190 7:112801042-112801064 CCCAACAGTCTGTTTTGTTCTGG + Intergenic
1031389122 7:121191398-121191420 CTCCTCAGCCTGTCTTGTACTGG - Intronic
1033210789 7:139458816-139458838 CCCAGAAGCCTGTTTTGCTCAGG - Intronic
1035170421 7:157014336-157014358 CGCGGGAGCCTGCTTTCTACAGG + Intergenic
1035743468 8:1945634-1945656 CCTGGCAGCATGTTGTGAACAGG - Exonic
1036286641 8:7448842-7448864 CCAGACAGCCTGTTTTGTGCTGG + Intronic
1036334836 8:7862682-7862704 CCAGACAGCCTGTTTTGTGCTGG - Intronic
1061479609 9:130890672-130890694 CCCAGGAGCCTGTTTTGTTTGGG + Intergenic
1062492779 9:136815318-136815340 ACCTGCAGCCTTTTTTGTTCGGG + Intronic
1062698002 9:137885180-137885202 CCAGGCAGCCTGGGTTGTGCAGG + Intronic
1189466409 X:41281033-41281055 CCCGGCCGCCTGTTTCTTAATGG + Intergenic
1191178819 X:57537503-57537525 CCCAGTTGCCTGTTCTGTACAGG - Intergenic
1196830454 X:119771756-119771778 CCCGGCCGCCTCTTTTATAAGGG + Intergenic
1198314060 X:135449423-135449445 CCCAGTAGCCTGCTTTGCACAGG + Intergenic