ID: 968306416

View in Genome Browser
Species Human (GRCh38)
Location 3:197654390-197654412
Sequence GGGGGAGACCGCGGGGGACC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968306411_968306416 -10 Left 968306411 3:197654377-197654399 CCGGGCAGCGGACGGGGGAGACC No data
Right 968306416 3:197654390-197654412 GGGGGAGACCGCGGGGGACCCGG No data
968306404_968306416 0 Left 968306404 3:197654367-197654389 CCCCAGGAGACCGGGCAGCGGAC No data
Right 968306416 3:197654390-197654412 GGGGGAGACCGCGGGGGACCCGG No data
968306406_968306416 -2 Left 968306406 3:197654369-197654391 CCAGGAGACCGGGCAGCGGACGG No data
Right 968306416 3:197654390-197654412 GGGGGAGACCGCGGGGGACCCGG No data
968306405_968306416 -1 Left 968306405 3:197654368-197654390 CCCAGGAGACCGGGCAGCGGACG No data
Right 968306416 3:197654390-197654412 GGGGGAGACCGCGGGGGACCCGG No data
968306399_968306416 21 Left 968306399 3:197654346-197654368 CCGGGCAGGAGGCAGGGGCGGCC No data
Right 968306416 3:197654390-197654412 GGGGGAGACCGCGGGGGACCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968306416 Original CRISPR GGGGGAGACCGCGGGGGACC CGG Intergenic
No off target data available for this crispr