ID: 968306488

View in Genome Browser
Species Human (GRCh38)
Location 3:197654544-197654566
Sequence GGGGGAGGCCGCTGGGGACC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968306465_968306488 30 Left 968306465 3:197654491-197654513 CCGCGGGGGTCCGGGCAGGGGCG No data
Right 968306488 3:197654544-197654566 GGGGGAGGCCGCTGGGGACCCGG No data
968306470_968306488 20 Left 968306470 3:197654501-197654523 CCGGGCAGGGGCGGGGGAGACGG No data
Right 968306488 3:197654544-197654566 GGGGGAGGCCGCTGGGGACCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968306488 Original CRISPR GGGGGAGGCCGCTGGGGACC CGG Intergenic
No off target data available for this crispr